Phaenoglyphis stricta (Thomson, 1877)

Vogel, Jonathan, Peters, Ralph S., Selfa, Jesús & Ferrer-Suay, Mar, 2024, Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data, Biodiversity Data Journal 12, pp. e 120950-e 120950 : e120950-

Phaenoglyphis stricta (Thomson, 1877)

Materials

Type status: Other material. Occurrence: recordedBy: Sv. Thygeson & Endrestol; individualCount: 1; sex: male; disposition: in collection; associatedSequences: NOFIG 1005-16; occurrenceID: EF4EB66E-EA90-5319-A693-2C385B87F602; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: stricta ; scientificNameAuthorship: (Thomson, 1877); Location: country: Norway; countryCode: NO; stateProvince: Aust-Agder; municipality: Froland; locality: Jurdalsknuten ; verbatimElevation: 330 m; decimalLatitude: 58.6210; decimalLongitude: 8.2450; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventDate: 2010-8 - 19; year: 1877; Record Level: language: en; institutionID: NINA; collectionID: NOFIG 883; basisOfRecord: PreservedSpecimen

Type status: Other material. Occurrence: recordedBy: Odegaard, Frode; individualCount: 1; sex: female; disposition: in collection; associatedSequences: NOFIG 732-16; occurrenceID: 63646654-B360-5216-8441-B78FD3D7B2F9; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: stricta ; scientificNameAuthorship: (Thomson, 1877); Location: country: Norway; countryCode: NO; stateProvince: Ostfold; municipality: Hvaler; locality: Soendre Sandoey ; verbatimElevation: 14 m; decimalLatitude: 59.0080; decimalLongitude: 11.0830; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventDate: 2014-4 - 25; year: 1877; Record Level: language: en; institutionID: NINA; collectionID: NOFIG 610; basisOfRecord: PreservedSpecimen

Diagnosis

Antennae of both sexes with rhinaria beginning on the last two thirds of F 1, pedicel shorter than F 1, F 1 longer than F 2, F 2 - F 4 subequal in length (Fig. 3 e); notauli present, scutellar foveae straight laterally, open anteriorly and posteriorly (Fig. 4 e).

Molecular characterisation

Maximum barcode-distance within species: 0.9 % (2).

Minimum barcode-distance to closest species: 12 % ( P. xanthochroa ).

Consensus barcode sequence (652 bp):

5 ’ - GATATTATATTTTATTTTTGGTGTGTGATCTGGAATAATTGGGTCATCTTTAAGATTAATTATTCGAATAGAATTAGGAACACCAAACCAATTAATCGGAAATGATCAAATTTATAATTCTATTGTTACTGCYCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAGTAGGAGGGTTTGGTAATTATTTAATTCCTTTAATATTATCCGCCCCCGATATAGCTTTCCCTCGTTTAAATAATATAAGATTTTGACTTTTACCTCCTGCTTTATTATTATTAACATCTAGAATATTTATTGATCAAGGGGCTGGAACAGGGTGAACAGTGTATCCTCCTTTATCATCTAATTTAGGTCATTCAGGYATTGCAGTTGATTTAACAATTTTTTCTTTACATATAAGAGGAATTTCATCAATTTTAGGGTCAATTAATTTTATTACAACAATCTTAAATATACGAATTGTTTCAYTAGATAAAATTTCTTTATTTATTTGATCCATTTTTTTAACAACAATTTTATTGTTATTATCTTTACCAGTATTAGCTGGAGGTATTACTATATTACTTTTTGATCGAAATTTAAATACYTCTTTTTTTGACCCTATAGGAGGAGGRGATCCTATTTTATAYCAACATTTATTT- 3 ’

Distribution

Andorra, Denmark, Finland, France, Germany, Mexico: Mexico City, Norway, Russia: Murmansk Oblast, Sweden, United Kingdom: England, and USA: Arizona, Iowa ( Hellén 1963, Ferrer-Suay et al. 2013, Ferrer-Suay et al. 2014, Ferrer-Suay et al. 2023).

Taxon discussion

The specimens with their corresponding barcodes and identification were published prior to this study on BOLD. Though its occurrence in Norway has not been published in a scientific journal, we refrain from claiming to be the first to record the species for Norway, as this information was publicly available prior to this study.

Figures

Figure 3. SEM images of female Phaenoglyphis antennae (all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).

Figure 4. SEM images of Phaenoglyphis mesoscutum (dorsal view; all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).