Phaenoglyphis longicornis (Hartig, 1840)

Vogel, Jonathan, Peters, Ralph S., Selfa, Jesús & Ferrer-Suay, Mar, 2024, Characterising the north-western European species of Phaenoglyphis Förster, 1869 (Hymenoptera: Figitidae: Charipinae) with novel insights from DNA barcode data, Biodiversity Data Journal 12, pp. e 120950-e 120950 : e120950-

Phaenoglyphis longicornis (Hartig, 1840)

Materials

Type status: Other material. Occurrence: recordedBy: GBOL III; individualCount: 1; sex: female; disposition: in collection; occurrenceID: D005101E-67AD-5398-BDA3-687A09723391; Taxon: family: Figitidae ; genus: Phaenoglyphis ; specificEpithet: longicornis ; scientificNameAuthorship: (Hartig, 1840); Location: country: Germany; countryCode: DE; stateProvince: Hesse; municipality: Werra-Meißner-Kreis; locality: Frankershausen, Nat. res., " Kripp- und Hielöcher " (Loc. 5.2) ; verbatimElevation: 302 m; decimalLatitude: 51.2491; decimalLongitude: 9.9198; Identification: identifiedBy: Mar Ferrer-Suay; dateIdentified: 2023; Event: eventID: 141; samplingProtocol: Malaise trap; eventDate: 2020-10 - 14 / 27; year: 1840; habitat: Small Pinus sylvestris forest with lots of dead wood; Record Level: language: en; institutionID: ZFMK; collectionID: ZFMK-TIS- 2641246; basisOfRecord: PreservedSpecimen

Diagnosis

Antennae of both sexes with rhinaria beginning on F 1, pedicel shorter than F 1, F 1 longer than F 2, F 2 subequal to F 3, F 3 shorter than F 4 (Fig. 3 c); pronotal carinae present, notauli present, scutellar foveae oval, with straight anterior and anterolateral margins, separated by median carina, open posteriorly (Fig. 4 c), propodeal carinae present; radial cell closed, 2.7 times as long as wide.

Molecular characterisation

Maximum barcode-distance within species: not applicable (1).

(Minimum) barcode-distance to closest species: 4.9 % ( P. salicis ).

Barcode sequence (652 bp):

5 ’ - TTTATTGTATTTTATTTTTGGAATTTGATCGGGTATAATCGGGTCAGCTTTAAGAATAATTATCCGAATAGAATTAGGAACCCCATCTTCATTAATCGGTAATGATCAAATTTATAATTCAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTCATACCAATTATAGTAGGGGGATTTGGAAATTATTTAGTTCCTCTAATATTAAGTGCTCCTGATATAGCTTTCCCACGATTAAATAACATAAGTTTTTGATTATTACCTCCTGCTTTATTTCTATTAATTTCTAGAATATTTATTGATCAAGGGGCTGGAACTGGATGAACTGTTTATCCTCCTCTTTCATCTAATATAGGCCATTCAGGAATTTCAGTAGATTTAACTATTTTTTCTTTACATTTAAGGGGAATTTCTTCTATTTTAGGGGCTATTAATTTTATTTCAACAATTTTAAATATACGAATTATTTCTTTAGATAAAATTTCTTTATTTATTTGATCTATTTTTTTAACAACTATTTTATTATTATTATCATTACCTGTATTAGCAGGAGGAATTACTATATTATTATTTGATCGAAATTTAAATACTTCTTTTTTTGATCCAATGGGAGGGGGAGACCCTATTTTATATCAACATTTATTT- 3 ’

Distribution

France, Germany, India, Romania, Spain, Sweden and United Kingdom: England, Scotland ( Ferrer-Suay et al. 2023).

Taxon discussion

The species P. salicis and P. longicornis were inferred as conspecific only in the second-ranked partition in analyses with ASAP, but separate in all others, which is in line with our morphological concept of the two species.

Figures

Figure 3. SEM images of female Phaenoglyphis antennae (all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).

Figure 4. SEM images of Phaenoglyphis mesoscutum (dorsal view; all images show corresponding holotypes): a P. belizini; b P. evenhuisi; c P. longicornis; d P. salicis; e P. stricta; f P. villosa; g P. xanthochroa. Images are taken from Ferrer-Suay et al. (2019).