Chthonolpidiales Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Chthonolpidiales Tedersoo ord. nov.

Type family.

Chthonolpidiaceae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; two mismatches allowed). Forms a monophyletic, least inclusive clade in Chthonolpidiomycetes, covering sequences EUK 1124876 , EUK 0534797 , EUK 0534798 , EUK 0534818 , EUK 1191212 , and EUK 1138033 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Chthonolpidiaceae (fam. nov.).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.