Dobrisimastigales Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Dobrisimastigales Tedersoo ord. nov.

Type family.

Dobrisimastigaceae Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 700–719 in S. cerevisiae ctggtgaatcatcgtgctct; one mismatch allowed) and LSU D 1 (positions 124–138 in the type species and 122–136 in S. cerevisiae tgggtaggttacctg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Dobrisimastigomycetes, covering sequences EUK 1189296 , EUK 1138904 , EUK 0534669 , EUK 0534670 , and EUK 0534680 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Dobrisimastigaceae (fam. nov.).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.