Savannolpidiaceae Tedersoo & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Savannolpidiaceae Tedersoo & Esmaeilzadeh-Salestani fam. nov.

Type genus.

Savannolpidium Tedersoo & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 - LSU interface (LSU positions – 2–18 in type species and S. cerevisiae aagtgatctgaaatcagaca; one mismatch allowed) and ITS 2 (positions 137–151 in type species gcgtactccttgtcc; two mismatches allowed) and SSU V 8 (positions 1589–1608 in S. cerevisiae atgattcatcagatcatgct; one mismatch allowed). Forms a monophyletic, least inclusive clade in Savannolpidiales, covering sequences EUK 1191209 , EUK 1191210 , EUK 0534704 , EUK 1124874 , EUK 1701673 , EUK 1701672 , and EUK 1124875 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Savannolpidiaceae includes Savannolpidium (gen. nov.) and other potential genera represented by sequences EUK 1701673 (forest soil in Madeira), EUK 1701672 ( woodland soil in Benin), EUK 0534781 (forest soil in Iraqi Kurdistan), EUK 1124875 (forest soil in Estonia), EUK 1191209 (forest soil in Puerto Rico), and EUK 0534704 (forest soil in Turkey).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.