Bowie fascination Jaeger , 2022

Chu, Chang, Lu, Ying, Li, Shuqiang & Yao, Zhiyuan, 2022, Taxonomic notes on eleven species of the subfamily Cteninae (Araneae, Ctenidae) from Asia, Biodiversity Data Journal 10, pp. 96003-96003 : 96003

publication ID

https://dx.doi.org/10.3897/BDJ.10.e96003

publication LSID

lsid:zoobank.org:pub:2A9D4A67-DC00-40DC-9745-BF531D767F55

persistent identifier

https://treatment.plazi.org/id/17AE53CC-49AB-5805-BCFB-4FD7C159B895

treatment provided by

Biodiversity Data Journal by Pensoft

scientific name

Bowie fascination Jaeger , 2022
status

 

Bowie fascination Jaeger, 2022

Materials

Type status: Other material. Occurrence: recordedBy: F. Gao; individualCount: 1; sex: male; lifeStage: adult; Taxon: order: Araneae ; family: Ctenidae ; genus: Bowie ; Location : country: China; stateProvince: Yunnan; municipality: Puer ; locality: Jiangcheng County ; verbatimLatitude: 22°35.640'N; verbatimLongitude: 101°50.760'E; Event : samplingProtocol: Collected by hand in leaf litter; year: 2022; month: 7; day: 19-24; Record Level : institutionCode: IZCAS-Ar 43540 Type status: Other material. Occurrence: recordedBy: F. Gao; individualCount: 1; sex: female; lifeStage: adult; Taxon: order: Araneae ; family: Ctenidae ; genus: Bowie ; Location : country: China; stateProvince: Yunnan; municipality: Puer ; locality: Jiangcheng County ; verbatimLatitude: 22°35.640'N; verbatimLongitude: 101°50.760'E; Event : samplingProtocol: Collected by hand in leaf litter; year: 2022; month: 7; day: 19-24; Record Level : institutionCode: IZCAS-Ar 43541 GoogleMaps GoogleMaps GoogleMaps GoogleMaps

Description

Male (IZCAS-Ar 43540): See Fig. 15 View Figure 15 a-c, Fig. 16 View Figure 16 c, d and Fig. 28 a; figs 230-233 and 263-264 in Jäger (2022).

Female (IZCAS-Ar 43541): PL 9.9, PW 7.8, AW 4.1, OL 11.0, OW 7.3. Eye diameters and interdistances: AME 0.29, ALE 0.27, PME 0.32, PLE 0.39, AME-AME 0.31, AME-ALE 0.71, PME-PME 0.43, PME-PLE 1.32, AME-PME 0.32, ALE-PLE 0.38, clypeus AME 0.42, clypeus ALE 0.95. Palp and leg measurements: palp 10.0 (3.3, 1.9, 2.1, -, 2.7), I 23.0 (6.7, 3.9, 5.7, 5.0, 1.7), II 21.4 (6.4, 3.7, 5.1, 4.6, 1.6), III 18.6 (5.6, 3.0, 3.8, 4.6, 1.6), IV 26.1 (7.2, 3.4, 5.8, 7.6, 2.1). Leg formula 4123. Spination of palp and legs: palp 131, 100, 131, 3020; femora I p021, d111, r111, II p112, d111, r111, III-IV p111, d111, r112; patellae I-II 000, III-IV 101; tibiae I-II v22222, III-IV p11, d111, r11, v222; metatarsi I-II v222, III p111, d012, r111, v222, IV p121, d012, r111, v2122. Chelicerae with 3 promarginal, 4 + 1 retromarginal teeth and with elongated patch of 27 tiny denticles along entire cheliceral furrow. Retromargin of chelicerae close to fang base with 11 bristles. Ventral tarsi and metatarsi I-II with sparse scopula. Palpal claw with 5 secondary teeth, leg claws I-II with 1, III with 2 and IV with 3 secondary teeth. Position of tarsal organ: I 1.41, II 1.34, III 1.25, IV 1.44.

Copulatory organ (Fig. 16 View Figure 16 a, b and Fig. 21 View Figure 21 a). Epigynal field wider than long, anterior bands separated from epigynal field. Lateral teeth arising laterally from median plate, curved and with pointed tips. Median plate with constricted posterior part and without distinct humped areas in posterior view. Internal duct system with two large vulval folds. Spermathecae separated by less than their diameter, with distinctly developed two chambers, smaller chamber with distinct external rim. Fertilisation ducts pointing laterally.

Colour (Fig. 16 View Figure 16 e and f). Deep reddish-brown with darker patterns. Dorsal prosoma with characteristic lighter median band, widened behind eyes, eye field with sparse white hairs and with distinctly marked fovea and radial markings. Sternum, labium, gnathocoxae and ventral coxae reddish-brown without patterns and gnathocoxae with lighter distal lips. Chelicerae black. Palps and legs deep reddish-brown. Dorsal opisthosoma brown with black patches, anterior margin with lighter area. Lateral opisthosoma spotted. Ventral opisthosoma brown with posteriorly converging lines of spots. Anterior lateral spinnerets laterally dark, posterior lateral and median spinnerets and anal tubercle light.

Diagnosis

Large-sized Ctenidae (total length female 20.9). The species is assigned to the robustus -species group with the characteristics of stout tegular apophysis, simple stout embolus with broad base, presence of retro-proximal cymbial outgrowth, RTA arising medially to distally from palpal tibia, female possesses a transversally median plate with lateral teeth situated mainly laterally and not reaching the epigastric furrow. It resembles B. candidate Jäger, 2022 (see Jäger 2022: figs 254-262 and 280-284) by having similar lateral teeth (Fig. 16 View Figure 16 a and Fig. 21 View Figure 21 a), but can be distinguished by the median plate without distinct humped areas (Fig. 21 View Figure 21 a; median plate with humped areas best seen in posterior view in B. candidate ), by the spermathecae separated by less than their diameter and smaller chamber with distinct external rim (Fig. 16 View Figure 16 b, spermathecae separated by about their diameter and smaller chamber without distinct external rim in B. candidate ) and by the fertilisation ducts pointing laterally (Fig. 16 View Figure 16 b, fertilisation ducts pointing antero-medially in B. candidate ). For the diagnosis of male, see Jäger (2022).

Distribution

China (Yunnan, Fig. 1 View Figure 1 ); Vietnam (Dien Bien, type locality).

DNA Barcode

Male (IZCAS-Ar 43540):

TATTTGGATCTTGGGCTGCTATAGCTGGGACAGCTATAAGAGTATTAATTCGTATAGAGCTAGGTCATTCTGGTAGATTATTTGGTGATGATCATTTATATAATGTAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATGGTTATGCCTATTTTAATTGGTGGTTTTGGAAACTGATTAGTTCCTTTGATATTAGGGGCTCCTGATATATCTTTTCCTCGTATAAATAATTTATCTTTTTGATTACTCCCTCCTTCATTATTTTTGTTATTTATATCTTCTATGGTTGAGATAGGGGTGGGAGCTGGTTGGACAGTGTATCCTCCTTTAGCTTCTAGTATTGGCCATATAGGAAGATCAATAGATTTTGCTATTTTTTCTTTACATTTAGCGGGAGCTTCTTCTATTATAGGGGCTGTTAATTTTATTTCTACAATTATTAATATACGTTTGTATGGAGTAAGAATAGAAAAGGTGCCTTTATTTGTATGATCTGTTCTAATTACTGCAGTATTATTGCTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGACCCGGCTGGAGGAGGGGATCCAGTTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572108).

Female (IZCAS-Ar 43541):

TATTTGGATCTTGGGCTGCTATAGCTGGGACAGCTATAAGAGTATTAATTCGTATAGAGCTAGGTCATTCTGGTAGATTATTTGGTGATGATCATTTATATAATGTAATTGTTACAGCTCATGCTTTTGTAATAATTTTTTTTATGGTTATGCCTATTTTAATTGGTGGTTTTGGAAACTGATTAGTTCCTTTGATATTAGGGGCTCCTGATATATCTTTTCCTCGTATAAATAATTTATCTTTTTGATTACTCCCTCCTTCATTATTTTTGTTATTTATATCTTCTATGGTTGAGATAGGGGTGGGAGCTGGTTGGACAGTGTATCCTCCTTTAGCTTCTAGTATTGGCCATATAGGAAGATCAATAGATTTTGCTATTTTTTCTTTACATTTAGCGGGAGCTTCTTCTATTATAGGGGCTGTTAATTTTATTTCTACAATTATTAATATACGTTTGTATGGAGTAAGAATAGAAAAGGTGCCTTTATTTGTATGATCTGTTCTAATTACTGCAGTATTATTGCTTTTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACTGATCGTAATTTTAATACTTCTTTTTTTGACCCGGCTGGAGGAGGGGATCCAGTTTTATTTCAACATTTATTTTGATTTTTTG (GenBank accession number OP572107).

Kingdom

Animalia

Phylum

Arthropoda

Class

Arachnida

Order

Araneae

Genus

Bowie