Amynthas micronarius ( Goto & Hatai, 1898 )
publication ID |
https://doi.org/ 10.12651/JSR.2012.1.2.133 |
persistent identifier |
https://treatment.plazi.org/id/0D1D878E-FFED-FFD6-FF12-FAB2FE3AA449 |
treatment provided by |
Felipe |
scientific name |
Amynthas micronarius ( Goto & Hatai, 1898 ) |
status |
|
Amynthas micronarius ( Goto & Hatai, 1898)
[ Figs. 4-6 View Fig View Fig View Fig ]
Perichaeta micronaria Goto & Hatai, 1898: 74 View in CoL , text fig. 1, tab. 1. From Tokyo. Types, none previously known; now Neotype An 446 in NSMT Tokyo.
Pheretima micronaria : Michaelsen, 1900: 316 (“ perhaps belonging in P. divergens ”); Ohfuchi, 1937: 50, text fig. 8, Pl. I, photo. 8; Ohfuchi, 1957: 245 (misspelled “ micronalia ”); Ishizuka, 2001: 79, fig. 40 (wrong genus, segments miscounted).
Pheretima obtusa Ohfuchi, 1957: 244 , fig. 19. From Sonai, Sakishima, Ryukyu. Types?
Amynthas micronarius : Sims & Easton, 1972: 235; Easton, 1981: 54 (syn. ? shimaensis View in CoL , ? yamizoyamensis , ? obtusa ); Blakemore, 2003: 21 (syn. ? shimaensis View in CoL , ? yamizoyamensis , ? obtusa ; ? tamaensis , hinoharensis , ? hypogaea , ? edoensis ); Blakemore & Ueshima, 2011: 67.
[ Pheretima imperfecta Ishizuka, 1999 d: 229 , figs. 1-7. Syn. nov.? Described as either lacking spermathecae, or having them adiverticulate in 5/6 (one side), or 7/8 (one side); genital markings absent; caeca simple; size range 49-92 mm. The condition in the holotype is not explicitly stated and this name may be a ‘grab bag’ of degraded morphs that require comparison with A. oyuensis ( Ohfuchi, 1937) ].
Pheretima tamaensis Ishizuka, 1999 d: 231 , figs. 8-17, tab. 1 (that mistakes the position of each genital marking). [Miscited as “Ishizuka, 2000” in Ishizuka (2001: 69). Poorly described but with spermathecae adiverticulate in 6/7/8; male pores, if present, superficial (at least in type); genital markings absent, or in some of 17/18/19 median to male pore line (when present); prostate glands absent (always?); intestinal caeca simple. Size: 60-90 mm]. From Tokyo region.
[ Pheretima stipata Ishizuka, 1999 d: 236 , figs. 34-40, tab. 3. Syn. nov.? Spermathecal pores 6/7/8/9. GMs in 18 combined with male pores, possibly parthenogenetic artefact, as in its junior synonym Ph. octo Ishizuka, 2000 . From Tokyo].
Pheretima hypogaea Ishizuka, 1999 d: 234 , figs. 24-33, tab. 2. [Same as micronarius and tamaensis but with three pairs of spermathecae in 6/7/8/9]. From Meiji- Jingu and Ueno Parks in Tokyo, i.e., the same as type-locality of micronarius .
Pheretima elliptica Ishizuka, 1999 d: 237 , figs. 41-48, tab. 3. Syn. nov. [Same as micronarius , tamaensis etc. with three pairs of spermathecae in 6/7/8/9 but lacking genital markings (always?)]. From University of Tokyo (near Ueno), i.e. same as type-locality as micronarius .
Pheretima rufidula Ishizuka, 2000a: 15 , figs. 8-14, tab. 1. Syn. nov. [Misspelt “ P. rufidura ” in Ishizuka (2001: 14, 30). GMs absent]. From Takao in Tokyo too.
Pheretima semilunaris Ishizuka, 2000a: 18 , figs. 30-36, tab. 1. Syn. nov. [As A. nonsilvestris Blakemore, 2010 but lacking diverticula]. From Tokyo.
[ Pheretima subterranea Ishizuka, 2000a: 22 , figs. 48-56, table 3. Syn. nov? Also lacking GMs; all diverticula states present in one worm!]. From Tokyo too.
[ Pheretima octo Ishizuka, 2000a: 31 , figs. 81-89, tab. 1. Syn. nov? Spermathecal pores 5/6/7/8/9. GMs in 17 (18?) combined with male pores, as in senior synonym P. stipata Ishizuka, 1999 that has almost word-for-word justification. From Tokyo].
Pheretima edoensis Ishizuka et al., 2000: 181 , figs. 2-8. [Variously miscited and misdated as “ Ishizuka, 1999 ” or “Ishizuka, 2000” in Ishizuka (2001: 11, 54, 76, 101) for a figured specimen that, although misplaced in a section of species having four pairs of spermathecae, has only three pairs in 6/7/8/9, yet its GMs appear to comply with those of A. micronarius , etc.]. From Imperial Palace, Tokyo, i.e., same type-locality as micronarius .
Pheretima hinoharensis Ishizuka, 2000b: 187 , figs. 35- 42, tab. 1. [Misspelt “ hinoharaensis ” in Ishizuka (2001: 11, 18, 78, 101). Spermathecal pores in 5/6/7/8/9, often proceeded by a small glandular pore, and with markings in 17/18 & 18/19 as in A. micronarius . Possibly an amphimixic morph. The garbled Remarks justifying this species make little sense]. From Itsukaichi (not Hinohara?) on outskirts of Tokyo.
[‘ Pheretima ’ palarva Blakemore, 2003 (nom. nov. pro Pheretima parvula Ishizuka et al., 2000a: 186 , figs. 17-24 [non Perichata parvula Goto & Hatai, 1898 (?= Amynthas gracilis View in CoL ); nec Pheretima parvula Ohfuchi, 1956 (= Metaphire parvula ). Name mis-cited and misspelt as ‘ Pheretima parvola Ishizuka, 2000 ’ by Ishizuka (2001: 12, 69, 102) and “ P. parvora ” by Ishizuka (2001: 46)]. Syn. nov.? Has “ Two pairs of spermathecal pores situated in furrows 6/7/ 8 in ventro-lateral sides, and occasionally absent, variable in number, separated by a distance of ca. 1/3 body circumference.” It lacks GMs and often one or both male pores, thus it could actually be any of a number of prior species but may well comply within a broad diagnosis of A. micronarius . From (Imperial Palace) Tokyo, i.e. same locality as edoensis synonym of micronarius . Recombined as “ Amynthas palarvus ” in Blakemore (2010a: 193), as a ‘nonsense’ name, it should actually be maintained as A. palarva ].
[ Amynthas nonsilvestris Blakemore, 2010a: 193 (nom. nov. pro Pheretima silvestris Ishizuka, 2000a: 18 , figs. 23-29, tab. 1, non Pheretima silvestris Michaesen, 1923 ). Spermathecal pores 5/6/7/8/9. GMs absent. From Tokyo].
Material examined. Neotype NMST An446 from Saito Ho-on Kai collection: (sample tube #19) labeled “ Ph micronaria Goto & Hatai ” with location and collector not noted; one of two previously undissected matures here dissected and sketched (90 mm long with markings in 17/18 & 18/19); the other, specimen NMST An447 (100 mm long with markings in 17/18 only). Specimen (90 mm long) NMST An445 (tube #18), a previously undissect- ed mature specimen, here dissected and sketched, label- ed “ Ph sp Sendai, Naga-machi, Kamohara’s home (in kanji) 16/ VI /1931 ” collector not noted. UMUTZ-Ann- OG-35 remnant labels written by Professor S. Goto or Dr S. Hatai had: “ Perichaeta micronaria Tokyo ”+“No. 4”+“6/91” [June 1891?]; two damaged specimens, seemingly mature, that whilst on loan had been allowed to dry out and are now in poor condition, i.e., contemporaneous topotypes but since neither was dissected they were probable, but not proven, actual syntypes. Also UMUTZ- Ann-OG-36 labeled “ Perichaeta micronaria ” with kanji for Meiji 29 and 8 th month [= August 1896] from “Tozaki, Kikkuchi, Kumamoto-ken collected by Mr Takiyama”-a batch containing many life stages of Amynthas corticis species-complex and possibly A. micronarius with at least one dissected (110 mm long and with GMs in 17/18 only) but, as noted by Blakemore & Ueshima (2011), not syntypes because this was not the stated “ Tokyo ” type-locality. Note: Both the Tokyo Museum and Tokyo University lots of these historical specimens had been loaned out by Mr Ishizuka since 1981-more than thirty years previously-but their significance was seemingly unrealized and this crucial material was ignor- ed and unpublished without distracting from numerous “new” species, many of which were homonyms and most of which were synonyms as noted above and by Blakemore (2003; 2008; 2012a; 2012b) and by Blakemore & Ueshima (2011).
A Watarase, Tochigi-ken specimen unregistered in Yokohama National University ( YNU), collected by Dr T. Kamitani April, 2003 from his Control site R (dissected and sketched by RJB). Kamakura specimens collected by RJB, Yuko Hiramoto & Amanda Reed, 12 th April 2004 from Kuzuharagaoka Shrine along with seven other species; plus other specimens collected by RJB from bamboo groves and organic farms at Ami, Ibaragi-ken 27 th July 2006 (all in YNU collection).
Japanese specimen ( NIBR IV0000249941 ) posterior amputee, mature, collected by RJB and T. J. Tansy 23 rd May 2012 from Nogeyama , Sakuragi-cho, Yokohama, Japan .
Korean specimen ( NIBR IV0000246442 ) collected by RJB 19 th March 2012 from NIBR Incheon’s Jeju Island Biosphere display along with A. tralfamadore Blakemore, 2012 and an immature lumbricid ( IV0000246443 )- this paper’s subjects .
Jeju-do Island specimens ( NIBR IV0000250396-7) 8 mature specimens, collected by RJB, TaeSeo Park & Insul, 21 st June, 2012 from Hyonyungsa Temple, Mt Halla, Jeju-do (thus newly confirming its presence on the mountain).
Description. Colourless (partly transparent) or pale pinkish grey in life, a light buff or grey in alcohol with clitellum either darker or lighter (some specimens darker). Length ca. 49-120 mm by 2.5-4.5 mm with 61-110 segments [neotype 90 mm long with 80 segments; stated as either 66 or 55 mm with either 106 or 102 segments by Goto & Hatai (1898: 74 vs. tab. 1); Ohfuchi’s specimens and Ishizuka’s synonyms range 66-119 mm and 90-120 mm, respectively; Ohfuchi’s obtusa body lengths vary 49-54 mm]. First dorsal pore (often minute) in 11/12. Setae 25-51 [Goto & Hatai have 28-32 in spermathecal segments and 35+ more posteriorly; Ohfuchi (1937: 52) details 25-51 in forty-six specimens; Korean specimens have ~40 on segment 12 and 48+ further back]. Spermathecal pores four pairs in 5/6/7/8/9 (e.g. neotype) or three pairs in 6/7/8/9 if anterior pair absent (e.g. An445, some Ibaragi specimens and synonyms) or, possibly, fewer spermathecae (synonyms), ca. 0.3 C apart. [Note: Spermathecal circumferencal ratios may be calculated in various ways as from the camera lucida figures but mean little in soft-bodied worms having different preservation techniques]. Male pores superficial on segment 18 with 7-12 setae intervening (Goto & Hatai say “8” but show 10) or absent in some morphs. Genital markings paired anteriorly in 18 and 19 but mostly appearing intersegmental in 17/18 (e.g. specimen An447) or 17/18 & 18/ 19 (neotype and An445) just median to the lines of the male pores, some morphs lack one or more GMs, but when present glands correspond internally. Prostates as figured (sometimes aborted). Septa 8/9 and 9/10 aborted (sometimes partially). Spermathecal diverticula clavate or variously degraded and/or deleted: often adiverticulate or partially stalked, or small terminal diverticular bulbs may be present (sometimes filled with coagulum but not necessarily iridescent). Hearts in 10-13. Holandric with testis in sacs in 10 and 11 (not always iridescent), seminal vesicles in 11 & 12. Intestine from 15 or 16; intestinal caeca from 26 or 27 simple with smooth margins; intestinal typhlosole vacularized and lamellar from ca. 26. Gut contains soil with few grits and often charcoal grains, i.e. geophagous.
Behaviour. “ The motion of this worm is very active and swift, and when dug from the ground, they wriggle and bounce about very quickly ” ( Ohfuchi, 1937: 50).
Distribution and habitats. Type-locality in Tokyo. Regarding the neotype, it is unknown but localities of other specimens in the collection included Komaba, Tokyo according to Ohfuchi (1937: 113). A species obviously subject to transportation that masks its origin; in Japan it occurs from Hokkaido to Ryukus ( Easton, 1981). Newly recorded from Korea, the NIBR specimen’s probable provenance from Jeju, subsequently supported on material recovered at Mt Halla (RJB pers. obs.).
Japanese material from around shrine gardens, farms and other disturbed sites, or “ generally found near houses ” ( Ohfuchi, 1937). Under moss at NIBR Jeju facility. Under rocks at Nogeyama park. In soil near graveyards at Mt Halla Temple , Jeju .
mt DNA COI data for Amynthas micronarius samples:
Tokyo neotype NMST An446-nil result .
Specimens, NMST An445 and An447-nil results.
>WO1 Korean A. micronarius specimen IV0000246442 from NIBR’s Jeju biosphere: TTTATACTTCATCTTAGGGATCTGAGCCGGAAT AATTGGTGCCGGAATAAGATTACTCATTCGAGT CGAATTAAGACAACCCGGACCATTTCTAGGTAG GGATCAACTATACAATACAATTGTAACCGCACA CGCATTCTTAATAATCTTCTTTCTAGTAATGCCA GTATTTATTGGAGGATTTGGAAATTGATTACTA CCTCTAATGTTGGGAACACCAGATATAGCATTC CCACGTCTAAATAACATGAGATTTTGATTATTA CCTCCGTCACTTATTTTACTCGTTTCATCTGCAG CCGTAGAAAAAGGAGCGGGAACAGGGTGAACA GTATACCCCCCGCTAGCAAGAAACATTGCCCAT GCCGGGCCATCAGTAGACCTTGCAATTTTCTCA CTACACTTAGCAGGAGCCTCCTCAATTTTAGGG GCAATTAACTTTATTACTACAGTAATTAACATG CGATGATCGGGACTACGCTTAGAACGAATTCCC CTATTCGTATGGGCAGTCGTAATCACCGTAGTA TTACTTCTTCTATCACTACCAGTATTAGCGGGA GCCATTACAATACTTCTTACAGACCGAAACCTT AACACATCGTTCTTTGATCCAGCAGGTGGGGGG GACCCTATTCTATACCAGCACCTGTTTTG BLASTn ver. 2.2.26+ (http://www. http://blast.ncbi.nlm. nih.gov/June, 2012):
Identities=634/634 (100%), Gaps=0/634 (0%) for GenBank AB 542498-AB542501 “ Amynthas micronarius ” vouchers from Miyagi, Niigata, Hyogo and Kagawa-ken, Japan (http://www.ncbi.nlm.nih.gov/genbank/June, 2012). Thus identity is supported .
Remarks. Ishizuka’s Pheretima hinoharensis is likely synonymous (previously in Amynthas corticis species-complex), the glands near the spermathecal pores rather irrelevant in parthenogenetic polymorphs, or possibly underdeveloped or overlooked in other specimens. Moreover, Ishizuka’s Pheretima hypogaea and P. edoensis with three pairs of spermathecae are exactly similar, and so too is his P. tamaensis with two (adiverticulate) pairs. All three are mere morphal variations belonging to Goto & Hatai’s prior taxon. Anterior spermathecae in ‘typical’ specimens of A. micronarius are often atrophied as if in the process of disappearing as indeed often occurs, indicative of involvement in a polymorphic complex. Thus two other NSMT specimens are mostly identical to the neotype (An446), apart from one (An445) lacking the anterior pair of spermathecae and one (An447) having markings in 17/18 only.
The new Korean and Japanese specimens comply with the species diagnosis, including figured specimens from Watarase and NIBR (as also in the P. subterranea synonym), where one worm has all three spermathecal diverticula states: from diverticulate or stalked only to adiverticulate, demonstrating the inconsequence of this character.
The current synonymy above now requires comparisons with Korean Amynthas bamsagolensis Hong & James, 2001 that, following Blakemore (2012a), is held under A. carnosus ( Goto & Hatai, 1899) , and with A. sangumburi Hong & Kim, 2002: 198 also from Jeju Island that appears an indistinguishable syn. nov. of Amynthas subrotunda (Ishizuka, 2000) comb. nov. itself provisionally held in an Amynthas corticis species-complex in a review by Blakemore (2003) 10 years earlier.
Amynthas shimaensis and A. yamizoyamensis are retained as described below.
VI |
Mykotektet, National Veterinary Institute |
YNU |
Yokohama National University |
T |
Tavera, Department of Geology and Geophysics |
R |
Departamento de Geologia, Universidad de Chile |
NIBR |
National Institute of Biological Resources |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
Kingdom |
|
Phylum |
|
Class |
|
Order |
|
Family |
|
Genus |
Amynthas micronarius ( Goto & Hatai, 1898 )
Blakemore, Robert J. 2012 |
Amynthas nonsilvestris
Blakemore, R. J. 2010: 193 |
Ishizuka, K. 2000: 18 |
Pheretima rufidula
Ishizuka, K. 2001: 14 |
Ishizuka, K. 2000: 15 |
Pheretima semilunaris
Ishizuka, K. 2000: 18 |
Pheretima subterranea
Ishizuka, K. 2000: 22 |
Pheretima octo
Ishizuka, K. 2000: 31 |
Pheretima edoensis
Ishizuka, K. 2001: 11 |
Ishizuka, K. & F. Shishikura & M. Imajima 2000: 181 |
Pheretima hinoharensis
Ishizuka, K. 2001: 11 |
Ishizuka, K. 2000: 187 |
Amynthas micronarius
Blakemore, R. J. & R. Ueshima 2011: 67 |
Blakemore, R. J. 2003: 21 |
Easton, E. G. 1981: 54 |
Sims, R. W. & E. G. Easton 1972: 235 |
Pheretima micronaria
Ishizuka, K. 2001: 79 |
Ohfuchi, S. 1937: 50 |
Michaelsen, W. 1900: 316 |
Perichaeta micronaria
Goto, S. & S. Hatai 1898: 74 |