Mirabilomyces abrukanus Tedersoo & R. H. Nilsson, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Mirabilomyces abrukanus Tedersoo & R. H. Nilsson sp. nov.

Diagnosis.

Separation from other species of Mirabilomyces based on ITS 2 (positions 68–87 cttcggttwtaaaacaaggt; two mismatches allowed) and LSU (positions 534–553 ctacgctgtggttgcgcttt; one mismatch allowed) as indicated in Fig. 54 . Intraspecific variation up to 11.4 % in ITS 2 due to length polymorphism in multiple mono- and dinucleotide repeats and up to 1.0 % in LSU. Interspecific distance> 20 % in ITS 2 and at least 6.0 % in LSU.

Type.

Vouchered soil sample TUE 000464 ( holotype); eDNA sequence EUK 1200676 = OZ 253813 ( legitype); eDNA sample TUE 100464 ( nucleotype); GSMc plot S 208, Tilia cordata temperate forest soil in Abruka , Estonia, 58.1568°N, 22.5004°E .

Description.

Other sequences: EUK 0483305 (temperate broadleaf forest soil in Arcais, France, 46.3038, – 0.6844°E); EUK 1124377 ( GSMc plot G 5235, Larix decidua plantation soil in Rõõmu, Estonia, 58.3835°N, 26.7742°E); EUK 1216948 ( GSMc plot G 4777, flooded grassland soil in Suur-Pakri Härs-hämani, Estonia, 59.3310°N, 23.9272°E); EUK 1216949 ( GSMc plot G 4679, Salix triandra wetland soil in Prangli Rivimaa, Estonia, 59.6150°N, 24.9871°E); OU 939561 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E); EUK 1202060 ( GSMc plot G 4747, Prunus-Rhamnus-Euonymus forest soil in Tsirgumäe, Estonia, 57.5942°N, 26.3241°E); EUK 1216950 ( GSMc plot G 4742, Fraxinus-Ulmus forest soil in Lüütre, Estonia, 58.1444°N, 25.2628°E); and EUK 1216946 ( GSMc plot S 1366, temperate grassland soil in Innhavet, Norway, 67.9676°N, 15.9277°E).

Etymology.

Mirabilis (Latin) refers to the remarkable and astonishing finding of a large, unrecognized fungal lineage, and Abruka (Estonian) refers to the type locality of the species.

Notes.

Found in grassland and forest soils in North and Central Europe (n = 57 records), with single records from Asia, North America, and Africa. GlobalFungi reveals no additional information.

Figures

Figure 54. Diagnostic nucleotide sequences of Mirabilomyces abrukanus relative to the closest related species in ITS 2 and LSU. Numbers indicate positions in the legitype (marked with an asterisk).