Palomastigaceae Tedersoo, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Palomastigaceae Tedersoo fam. nov.

Type genus.

Palomastix Tedersoo .

Diagnosis.

Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1664–1678 in S. cerevisiae tttagtgaggactcg; no mismatch allowed) and 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag or gcttcatggtattccgtga; one mismatch allowed). Forms a monophyletic, least inclusive clade in Palomastigales, covering sequences EUK 1124846 , EUK 1123686 , EUK 0320705 , and EUK 0320700 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Harbors Palomastix (gen. nov.) and potential genus-level taxa represented by sequences EUK 0574070 (marine sediment in the Philippines), EUK 0137263 (forest soil in Mexico), and EUK 1124846 (wasteland soil in Estonia).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.