Madecorphnus grebennikovi Frolov, Akhmetova & Vishnevskaya, 2020
|
publication ID |
https://doi.org/10.11646/zootaxa.4808.2.9 |
|
publication LSID |
lsid:zoobank.org:pub:8EDEC876-C608-46F4-91FE-13AB3F0DC029 |
|
persistent identifier |
https://treatment.plazi.org/id/03D45649-FF84-F174-FF61-2B21FC43FC1D |
|
treatment provided by |
Plazi |
|
scientific name |
Madecorphnus grebennikovi Frolov, Akhmetova & Vishnevskaya |
| status |
sp. nov. |
Madecorphnus grebennikovi Frolov, Akhmetova & Vishnevskaya , new species
(Figs. 1, 2)
Type material. Holotype: male at ZIN labeled “ Madagascar Marojejy -14.4367 49.7435 1321m 10.xii.2018 sift V. Grebennikov MD17 ”. GoogleMaps
Description. Holotype, male (Fig. 1). Body length 5.3 mm (with mandibles). Color of head and pronotum uniformly brown, disc of elytra and anterior part of head slightly lighter.
Right mandible as long as left, without tooth behind apex. Labrum subtrapezoidal, with slightly rounded sides, length about 1/8 width (in dorsal view). Clypeus symmetrical, apically obtuse, with two long and one shorter setae on the apical margin. Canthus and frontal suture indistinct. Clypeus slightly depressed apicomedially. Head without traces of frontoclypeal suture, finely punctate with minute punctures separated by greater than four times their diameter.
Pronotum approximately 1.6 times wider than long, widest medially. Disc of pronotum convex, without any depressions, tubercles, or ridges. Punctation on pronotum similar to that on head. Margins with relatively wide border, lateral margins with four long setae: one seta on basal angle, one seta approximately in the middle of lateral margin, and two setae on the apical angle.
Scutellum subtriangular, angulate apically, about 1/12 length of elytra.
Elytra convex, with distinct humeral and apical umbones, widest at middle. Stria I distinct and reaching the apex of elytron, other striae indistinct. Elytra with double punctation: entire surface with minute punctures similar to those on head and pronotum; disc with larger, sparse, elongate, setigerous punctures. Epipleura with long, sparse, brown setae. Base of elytron with border from scutellum to humeral callus. Wings fully developed.
Protibiae with three outer teeth, lateral margin basad of outer teeth not crenulate. Apex with robust, spur-like seta and a few smaller setae basally. Mesothoracic and metathoracic legs similar in shape to each other. Longer tibial spur slightly shorter than mesotarsomeres I–II in mesothoracic legs and as long as metatarsomeres I–II in metathoracic legs.
Parameres 0.6 length of phallobase, narrowly rounded in lateral view (Fig. 1F), their apical part as wide as basal part in dorsal view, with small but distinct lateral teeth (Fig. 1D). Endophallus with 1) a long, almost straight sclerite with attached to its end a 2/3 shorter, somewhat curved sclerite, 2) a separate smaller, elongate sclerite, and 3) a rather large area of microspinules (Fig. 1E).
Female unknown.
FIGURE 1. Holotype of Madecorphnus grebennikovi Frolov, Akhmetova & Vishnevskaya , new species. A, habitus, dorsal view; B, habitus, dorsolateral view; C, habitus, lateral view; D, parameres, dorsal view; E, endophallus; F, aedeagus, lateral view.
Diagnosis. The new species is distinguished from other Madecorphnus species by the unique combination of the shape of the parameres and armature of the endophallus, namely the parameres being narrowly rounded in lateral view and having a small but distinct lateral teeth, and the endophallic armature consisting of 1) a long straight sclerite with attached to its end a 2/3 shorted, somewhat curved sclerite, 2) separate smaller, elongate sclerite, and 3) a rather large area of microspinules.
DNA barcode. GenBank accession number MT361868 View Materials , length 811 base pairs: TAAAGATATTGGAACATTGTATTTCCTATTTGGAAGTTGAGCAGGAATAGTAGGAACCTCCCTA- AGCCTATTAATCCGTGCCGAACTAGGAAACCCTGGAACTTTAATTGGTGACGATCAAATTTATAAC- GTAATCGTAACAGCTCATGCATTTGTAATAATTTTTTTTATAGTAATACCTATTATAATTGGTGGGTTTG- GAAACTGACTTGTTCCATTAATGCTAGGTGCTCCCGACATAGCATTCCCTCGAATAAACAACATA- AGGTTTTGGCTTCTCCCCCCATCCTTAACACTTTTATTAACTAGAAGAATAGTTGAAAGTGGTGCAG- GTACAGGTTGAACGGTTTATCCTCCCCTTTCAGCTAACATTGCCCATAGAGGTGCATCTGTTGACCTA GCTATTTTTAGCCTTCACCTAGCAGGAATCTCTTCAATTCTAGGGGCTGTAAATTTTATTACTACAGTA- ATCAATATACGATCCACTGGAATAACTTTTGATCGAATACCTTTATTTGTATGGTCCGTAGCATTAACTG CTTTATTACTCTTGCTCTCYCTGCCTGTTTTAGCTGGTGCAATTACCATGTTATTAACAGATCGAAATT- TAAACACTACTTTTTTTGACCCAGCCGGAGGAGGCGATCCAATTCTATACCAACACCTATTTT- GATTCTTTGGACACCCAGAAGTATACATTTTAATTCTACCTGGATTTGGTATAATCTCCCATATTATT AGGCAAGAAAGAAGAAAAAAGGAAACTTTTGGTACTTTAGGTATAATTTATGCTATACTAGCAATTG- GATTA
Distribution. The species is known from the type locality only, the Marojejy National Park, Sava Region, northeastern Madagascar ( Fig. 2 View FIGURE 2 ).
Etymology. The new species is named after Vasily V. Grebennikov (Canadian Food Inspection Agency, Ottawa, Canada) who collected the type specimen. Noun in the genitive case.
| ZIN |
Russian Academy of Sciences, Zoological Institute, Zoological Museum |
| V |
Royal British Columbia Museum - Herbarium |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Orphninae |
|
Genus |
