Staphylus ( Scantilla ) freemani A. Warren & Lemes, 2025
|
publication ID |
https://doi.org/10.11646/zootaxa.5609.2.7 |
|
publication LSID |
lsid:zoobank.org:pub:16ED41B5-963F-40D8-8ACB-4AA0F42CDA80 |
|
DOI |
https://doi.org/10.5281/zenodo.15230802 |
|
persistent identifier |
https://treatment.plazi.org/id/03A60F08-FFF2-FF8D-9AF6-F95D4AF3F803 |
|
treatment provided by |
Plazi |
|
scientific name |
Staphylus ( Scantilla ) freemani A. Warren & Lemes |
| status |
sp. nov. |
Staphylus ( Scantilla) freemani A. Warren & Lemes View in CoL , sp. nov.
zoobank.org:act: B8A4A31E-DE61-4FBE-B449-C0974B9FB7E4
( Figs 1–3 View FIGURE 1 View FIGURE 2 View FIGURE 3 , 5–7 View FIGURE 5 View FIGURE 6 View FIGURE 7 )
Diagnosis. Staphylus ( Scantilla) freemani sp. nov. is readily distinguished from St. ( Sc) opites and St. ( Sc.) bondus sp. nov. in the presence of a costal fold in males DFW. This is the only species in the subgenus presenting a very pronounced concavity on the dorsal valva (see arrow on Fig. 5A View FIGURE 5 ); other species have the same region nearly straight or rounded.
Male description ( Fig. 2E–F View FIGURE 2 ). Head ( Fig. 3C–D View FIGURE 3 ): Brown with yellow scales dorsally; pure white ventrally, third segment of the palpi dark brown. Antennae brown dorsally, ventrally with small yellow dots at the base of the joints. Nudum with 11 segments. Thorax: Brown dorsally, with white scale-like hairs ventrally. Legs brown with white hair-like scales. FW length and shape: 13 mm – 16 mm (n = 6). Outer margin rounded. HW length and shape: 10 mm – 11 mm (n = 6). Outer margin slightly undulated. DFW: Brown. Costal fold present. Two paler transversal bands in the central and postdiscal areas. Presence of sparse paler scales. Fringe brown. VFW: Lighter brown. Fringe as in DFW. DHW: Brown. Two paler transversal bands in the central and postdiscal areas. Presence of a few pale scales and long, thin, brown hair-like scales. Fringe brown. VHW: Lighter brown. Presence of pale scales, predominantly on inner margin. Abdomen: Brown with pale scales ventrally. Genitalia ( Fig. 5 View FIGURE 5 ): Tegumen about as long as wide, rounded proximally, distally convex with two lateral triangular processes. Ventral arms of tegumen narrow and fused with dorsal arms of saccus, assuming that the boundary between these structures is at the angle between them. Saccus triangular, very short. Fenestra developed. Uncus with enlarged base, with a tuft of thin setae dorsally, distally tubular. Gnathos developed as two sclerotized plates that fuse ventrally becoming even more sclerotized, with relatively long microtrichia. Valva about two times longer than wide, dorsally with a very pronounced concavity; sacculus longer than wide, scalene triangle-shaped with a concave proximal region, bearing thin socketed spines internally; harpe broad, rounded distally, concave on its proximal margin, straight dorsally; ampulla longer than wide, wider at distal margin as a somewhat rectangular flattened process, dorsal margin with small tooth-like processes, not exceeding harpe and with a concave curvature at dorsal margin; costa poorly defined; harpe and ampulla with presence of setae externally and internally. Aedeagus cylindrical, about same length of valva; insertion of manica at the first third of aedeagus; without cornuti; ejaculatory bulb opening broad, dorsal; distal opening for vesica extending dorsodistally bearing small denticles laterally. Fultura superior and inferior developed, the inferior bearing a cluster of large, socketed spines directed posteriorly.
Female description ( Fig. 2G–H View FIGURE 2 ): Females differ from males as follows: FW length. 11 mm – 15 mm (n = 4). HW length. 8 mm – 12 mm (n = 4). Brown wings lighter than males with bands more visible and with two white dots in R 2 -R 3 and R 3 -R 4 of FW and two submarginal dots on FW. Genitalia ( Fig. 6 View FIGURE 6 ): Papilla analis semi-rounded, covered with setae; posterior apophysis straight, about same length as papilla analis. Lamella antevaginalis as a semicircular plate in ventral view, bearing microtrichia, with a deep centro-distal excavation. Lamella postvaginalis as two large, fused plates with a large concave region where the lamella antevaginalis is inserted; ostium bursae large and well delimited at the middle of lamella postvaginalis; laterally, lamella antevaginalis as a flat triangle. Ductus bursae membranous; corpus bursae membranous and globular, about 1/4 the length of the ductus bursae.
Barcode sequence of the male paratype ( specimen from Mexico, Jalisco, La Manzanilla ( MGCL1112069 ): Sample JRAL-COI-25, BOLD BIN AEO6547 , GenBank PV 258743, 658 base pairs:
AACTTTATATTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTTTAAGTATTCTTATTCGTTCAGAATTA GGAACTCCCGGATCTTTAATTGGAGATGATCAAATTTACAATACTATTGTAACAGCTCATGCTTTTATTATAATTT TTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATAT AGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCTCTTATACTTTTAATTTCAAGTAGTATC GTAGAAAATGGAGCAGGTACAGGATGAACTGTTTACCCCCCTCTTTCAGCTAATATTGCTCACCAAGGAGCATCTG TAGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTCTTGGAGCAATTAACTTTATTACAACTAT TATTAATATACGAATTAATAACTTATCATTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTA CTTTTACTTTTATCTTTACCAGTATTAGCAGGAGCTATTACAATACTTTTAACTGATCGAAACCTTAATACTTCAT TTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Remarks. The female genitalia illustration of Staphylus ( Sc.) freemani sp. nov. presented herein represents the first female genitalia illustration of the subgenus (see taxonomic catalogue in Mielke 2024).
Etymology. This species is named in honor of Hugh Avery Freeman, who first identified this taxon as undescribed, in recognition of his significant contributions to the study of Hesperiidae .
Distribution ( Fig. 7 View FIGURE 7 ). This new species appears to be restricted to coastal western Mexico, from Jalisco (and probably Nayarit), south to at least Zipolite, Oaxaca. Seven of nine currently known specimens are from the state of Colima, from the coastal valley around Manzanillo. All specimens have been collected at or near sea-level.
Type material. Holotype ( Fig. 2E–F View FIGURE 2 ) male deposited in MZFC, with the following labels: (lines separated by “/”): Mexico: Oaxaca / Zipolite , sea level / 10-VIII-1990 / John Kemner; Genitalia Vial / Number H-1084 / H. A. Freeman; Holotype / Staphylus freemani / A. Warren & Lemes / .
Allotype ( Fig. 2G–H View FIGURE 2 ) female deposited in USNM with the following labels (lines separated by “/”): Collection of / S. S. Nicolay / Manzanillo / Col.[ima] Mexico / 18 Jan. 1953; Collected by / Dr. J. A. Comstock; PHOTO; Photo / Allotype / Staphylus freemani / A. Warren & & Lemes / DNA Voucher JRAL-COI-26 José R. A. Lemes [ BOLD: AEO6547 ] /.
Paratypes. MEXICO – Colima: Manzanillo, 14.I.1953, 1♂, J. A. Comstock leg., Genitalia slide H52 Prep. S. S. Nicolay ( USNM) ; 19.XII.1952, 1♀, J. A. Comstock leg. ( USNM,) ; 31.XII.1952, 1♂, J.A. Comstock leg., Genitalia slide H188 Prep. S. S. Nicolay ( USNM) ; Playa de Oro, 3–5 Km NE, 30.XII.1995, 1♂, Andrew D. Warren & I. Vargas-F. leg., Genitalia Vial #97-15 Andrew D. Warren ( ADW) ; 30.XII.1995, 1♀, Andrew D. Warren & I. Vargas-F. leg., Genitalia Vial #97-16 Andrew D. Warren ( ADW) ; 2 km W Chandiablo, 2.I.1996, 1♀, Andrew D. Warren & I. Vargas-F. leg .; Guerrero: Ixtapa Zihuatanejo, 1-5.III.1985, 1♂, J. J. Bowe leg., FSCA Florida State Collection of Arthropods , MGCL / FLMNH Specimen nº. 36968 ( MGCL) . Jalisco: La Manzanilla, 24.XII.2000, D. L. Linsdley leg., JRAL-COI-25 [ BOLD: AEO6547 ] ( MGCL 1112069 ); 5–6 km NW Chico’s Paradise on Hwy. 200, 13.XI.1995, B. O’Hara ( ADW) . Michoacán: Arteaga, El Huarichito , 2.V.1997, 1♀, L. González-C. leg. ( MZFC) .
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
SubFamily |
Pyrginae |
|
Genus |
