Cubus jeffcummingi Zúñiga, Valerio & Hanson, 2025
|
publication ID |
https://doi.org/10.11646/zootaxa.5590.3.4 |
|
publication LSID |
lsid:zoobank.org:pub:8F0E3823-08CF-45F0-B7B5-2E2FF662035B |
|
DOI |
https://doi.org/10.5281/zenodo.14962240 |
|
persistent identifier |
https://treatment.plazi.org/id/03A3B16B-FFD4-FF89-63E2-0CF9FE404B78 |
|
treatment provided by |
Plazi |
|
scientific name |
Cubus jeffcummingi Zúñiga, Valerio & Hanson |
| status |
sp. nov. |
Cubus jeffcummingi Zúñiga, Valerio & Hanson , sp. nov.
( Figs. 2 View FIGURES 1–2 , 10 View FIGURES 9–10 , 21 View FIGURES 16–21 )
Diagnostic description. Female. Fore wing length 7.5–9 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 32–34 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput small, barely reaching level of inner eye margin; lower 0.6 of pronotum black; ventral mesothorax completely yellow; hind coxa with black mark on both internal and external surfaces; propodeum with a longitudinal black mark that is narrower near the middle (chalice- or hourglass-shaped); tergite I with median black line reaching middle of tergite, with posterior portion greatly expanded laterally.
Male. Similar to female.
Comments. Cubus jeffcummingi can be recognized by the combination of the small black mark on the occiput and the lateral pronotum with the ventral black area reaching beyond half the pronotal height. In one specimen (DHJPAR0050790, reared from Desmia Solis 19) the black mark on the occiput is large, nonetheless it groups with C. jeffcummingi in the NJ tree.
Hosts. This species was found in the San Cristobal, Orosi, Rincon Rain Forest, and Pitilla Sectors. It has been reared on 12 occasions from Desmia ploralis DHJ 01, Desmia Janzen 09, Desmia Solis 19, Syllepte Solis 22, Trichaea pilicornis , and spiloBioLep01 BioLep498 ( Crambidae ) feeding on Faramea multiflora , Psychotria chagrensis , P. grandis , and P. panamensis ( Rubiaceae ).
Etymology. This species is named in honor of Jeff Cumming of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.
Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0014089 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 01- SRNP-11830. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Del Oro, Mena Central , 11.02991, -85.45364, 345m (Tonny Lara) caterpillar feeding on Psychotria panamensis ( Rubiaceae ) coll. 31.x.2001 wasp eclosed 30.xi.2001 GoogleMaps . Paratypes. 10 ♀, 1 ♂, ( EMUS, MNCR, MZUCR, USNM). COSTA RICA, ACG database codes: (05- SRNP-4173: DHJPAR0009713 ( ♀) ; 06- SRNP-33766: DHJPAR0016379 ( ♀) ; 06- SRNP-33767: DHJPAR0016385 ( ♂) ; 07- SRNP-22365: DHJPAR0021637 ( ♀) ; 07- SRNP-22366: DHJPAR0021660 ( ♀) ; 09-SRNP-3191: DHJPAR0035973 ( ♀) ; 09- SRNP-3791: DHJPAR0036775 ( ♀) ; 10- SRNP-1948: DHJPAR0039367 ( ♀) ; 13- SRNP-4707: DHJPAR0053488 ( ♀) ; 13- SRNP-30943: DHJPAR0053527 ( ♀) ; 12- SRNP-5502: DHJPAR0050790 ( ♀) .
Barcode. DNA barcode of female holotype DHJPAR0014089 (626 bp): C AATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTTATAAATCCAATAAAACCATTAATTACTAATGATCA AATATACAATTCTTTAGTAACAATACATGCATTTTTAATAATTTTTTTTTTAGTTATACCTACAATAATTGGAGGA TTTGGAAATTGATTAGTTCCATTAATATTAGGAACACCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTT GACTTTTACCACCTTCAATAATTCTATTATTAATAAGTAGAATCATTAATCAAGGTCCAGGAACTGGATGAACAAT ATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATCCGTTGATTATGCTATTTTTTCTCTTCATATTGCA GGATCTTCCTCAATTATAGGAGCAATTAATTTTATTACAACAATTTTTAATTTAAAAATTAAAAATTTAAAAATAA GACAATTAAATCTTTTTTCATGATCAATTATTATTACATCAATCTTACTTCTTTTAGCTGTTCCTGTATTAGCAGG TGCTTTAACAATATTAATTTTTGATCGAAATTTAAATACTTCATTCTTTGATCCATCAGGAGGGGGAGATCCTATT CTTTTTCAACATTTATTT
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
