Cubus montywoodi Zúñiga, Valerio & Hanson, 2025
|
publication ID |
https://doi.org/10.11646/zootaxa.5590.3.4 |
|
publication LSID |
lsid:zoobank.org:pub:8F0E3823-08CF-45F0-B7B5-2E2FF662035B |
|
DOI |
https://doi.org/10.5281/zenodo.14953293 |
|
persistent identifier |
https://treatment.plazi.org/id/03A3B16B-FFCF-FF97-63E2-096BFB844D64 |
|
treatment provided by |
Plazi |
|
scientific name |
Cubus montywoodi Zúñiga, Valerio & Hanson |
| status |
sp. nov. |
Cubus montywoodi Zúñiga, Valerio & Hanson , sp. nov.
( Figs. 3, 8 View FIGURES 3–8 , 25 View FIGURES 22–26 )
Diagnostic description. Female. Fore wing length 5.1–7.5 mm. Malar space about 0.6 × basal mandibular width; combined face and clypeus (from clypeal apex to level of antennal sockets) about 1.6 × as high as wide (shortest distance between the eyes); posterior ocellus separated from eye by 0.6 × its own maximum diameter; antenna with 26–30 flagellomeres. Posterior projections of ventral mesothorax flattened and sharply pointed. Coloration. Black mark on occiput reaching laterally well beyond inner eye margin, with dorsal margin of black mark more or less parallel to eye margin; lower 0.5 or 0.6 of pronotum black; ventral mesothorax with at least some black; hind coxa completely yellow, without black marks; propodeum with black mark somewhat variable, either an elongate triangular black mark that narrows posteriorly, or chalice-shaped; tergite I completely yellow, without obvious black mark.
Male. Similar to female.
Comments: Cubus montywoodi and C johnstiremani . are the only species having the legs completely yellow, without any dark marks, not even on the hind coxa. Both species are also unique in having at least some black on the ventral mesothorax. However, they are easily distinguished by the form of the black mark on the propodeum ( Fig. 25 View FIGURES 22–26 vs Fig. 23 View FIGURES 22–26 ). In one specimen (DHJPAR0046772, reared from Herpetogramma Janzen 07) the black mark on the occiput is small, not reaching laterally beyond inner eye margin, and the black mark on the propodeum is a narrow triangle not reaching the posterior margin. Because there are only three specimens of C. montywoodi it is difficult to judge whether this deviant specimen is a distinct species or represents extreme intraspecific variation.
Hosts. This species was found in the Rincon Rain Forest Sector. It has been reared on 3 occasions from Desmia ploralis DHJ 01, Herpetogramma Janzen 07, and spiloBioLep01 BioLep375 ( Crambidae ) feeding on Psychotria panamensis , Sabicea panamensis ( Rubiaceae ), and Casearia arborea ( Salicaceae ).
Etymology. This species is named in honor of the late Monty Wood, formerly of the Canadian National Collection of Insects, in recognition of his contributions to the ACG tachinid fly inventory.
Material. Holotype. ♀. Deposited at EMUS. Specimen labels: 1. DHJPAR0017255 . 2. Caterpillar Voucher: D. H. Janzen & W. Hallwachs, DB: http://Janzen.sas.upenn.edu, Area de Conservation Guanacaste, Costa Rica, 07- SRNP-40486. Database information: Costa Rica, ACG, Guanacaste Prov., Sector Rincon Rain Forest, Puente Rio Negro, 10.90376, -85.30274, 340m (Minor Carmona) caterpillar feeding on Casearia arborea ( Salicaceae ) coll. 16. ii.2007 wasp eclosed 18.iii.2007 GoogleMaps . Paratypes. 2 ♀, ( MNCR). COSTA RICA, ACG database codes: (♀); 12-SRNP-67073: DHJPAR0046772 ( ♀) , 09-SRNP-44112: DHJPAR0035164 ( ♀) .
Barcode. DNA barcode of female holotype DHJPAR0017255 (660 bp): ATATTATATTTTATTTTAGGAATTTGATCAGGTACAATTGGAACTTCTACAAGTATAATTATTCGAATTCAACTAA TAAATCCAATAAAACCATTAATTACTAATGATCAAATATATAATTCTTTAGTAACAATACACGCATTTTTAATAAT TTTTTTTTTAGTAATACCTACAATAATTGGAGGATTCGGAAATTGATTAATTCCTTTAATATTAGGAACACCTGAT ATAGCATTCCCACGAATAAATAATATAAGATTTTGACTTCTACCTCCTTCAATAATTTTACTATTATTAAGTAGAA TTATAAATCAAGGTCCAGGTACTGGATGAACAGTATATCCACCATTATCATCTAATATTAGTCATGAAGGAATATC AGTTGATTATGCTATTTTTTCTCTTCATATTGCAGGATCCTCTTCAATTATAGGAGCAATTAATTTTATTACAACA ATTTTTAATTTAAAAATTAAAAATTTAAAAATAAGACAATTAACCCTTTTCTCATGATCAATTATTATTACATCAA TTTTACTTCTTCTAGCTGTACCTATTCTTGCAGGAGCATTAACAATATTAATTTTTGATCGAAATTTAAATACATC ATTTTTTGACCCCTCAGGTGGAGGAGATCCAATTCTTTTCCAACATTTATTT
| MNCR |
Museo Nacional de Costa Rica |
No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.
|
Kingdom |
|
|
Phylum |
|
|
Class |
|
|
Order |
|
|
Family |
|
|
Genus |
