Rhaphium spinulatum, Grootaert & Taylor & Guénard, 2019

Grootaert, Patrick, Taylor, Christopher & Guénard, Benoit, 2019, Three new species of Rhaphium Meigen, 1803 from mangroves in Hong Kong (Diptera: Dolichopodidae: Rhaphiinae), European Journal of Taxonomy 540, pp. 1-21 : 7-11

Rhaphium spinulatum sp. nov.

urn:lsid:zoobank.org:act:5CFE7569-8A05-4D7B-AC60-5AA30F5A0C87

Figs 3–4

Diagnosis

Small species with a long postpedicel, almost 6 × as long as wide, biseriate acrostichals, five pairs of dorsocentral bristles, simple cerci and surstyli apically simple. Scape and pedicel brown like postpedicel. Fore tarsomere 1 ventrally not produced, bearing a pair of curved apical spines. Surstylus dark brown.

Etymology

The new species is named after the distinctive spinules on the apex of the first tarsomere of the fore leg.

Material examined

Holotype

HONG KONG • ♂; Sam A Tsuen (5 AM1 ); 22.51534° N, 114.27121° E; 11–27 Dec. 2017; C. Taylor and U. Chang leg.; muddy back mangrove; RBINS.

Paratypes

HONG KONG • 2 ♂♂, 1 ♀; same collection data as for holotype; RBINS • 3 ex.; Tsim Bei Tsui (Sha Kiu Tsuen) (9EM1); 22.48902° N, 113.99832° E; 31 Oct.–15 Nov. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 9 ex.; To Kwa Peng (29M1); 22.42863° N, 114.33314° E; 29 Nov.–5 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 22 ex.; Ho Chung (Nam Wai) (38 AM1 ); 22.35347° N, 114.25622° E, 4–18 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 13 ex.; Ho Chung (38 BM1 ); 22.35366° N, 114.25207° E; 4–18 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 242 ex.; Tai Tan (28M1); 22.43857° N, 114.33327° E, 5–19 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 2 ♂♂, 2 ♀♀; same collection data as for preceding; barcoded; HKU • 7 ex.; Wong Chuk Wan (34M1); 22.39563° N, 114.28617° E; 5–19 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 2 ex.; Sam A Tsuen (5 AM1 ); 22.51534° N, 114.27121° E; 11–27 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 91 ex.; Sam A Chung (5 BM1 ); 22.50829 N, 114.27248° E; 11–27 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 34 ex.; Sai Keng (40M1); 22.42041° N, 114.26796° E; 18 Dec. 2017 – 2 Jan. 2018; C. Taylor and U. Chang leg.; barcoded; RBINS .

Barcodes

The barcodes below can be copy/pasted into a fasta file in order to compare with other species.

>doli_HKC0000197_Kareen-Nabilah_ INTRN 223_ HongKong _ 31Dec 9999_20180820 male Ho Chung (Nam Wai) 38 AM 1 GAATAAATGTTGATATAGTACAGGGTCTCCTCCTCCTGCGGGGTCGAAGAATGATGTATTT AAATTACGATCTGTTAATAACATAGTAATAGCTCCGGCTAGTACTGGTAATGATAATAATA ATAGAATTGCTGTAATTACTACAGATCAAACAAATAAGGGCATTCGGTCAAGAGTAATTCC AGTGGATCGTATATTAATTACTGTTGTAATAAAATTTACTGCCCCTAAAATTGATGAAATACC GGCAAGATGTAAAGAAAAAATAGCTAAATCAACAGAGGCACCACCATGAGCAATACCTGC AGACAGA

>doli_HKC0000137_Kareen-Nabilah_ INTRN 222_ HongKong _ 31Dec 9999_20180820 female Tai Tan 28M1 GAATAAATGTTGATATAGTACAGGGTCTCCTCCTCCTGCGGGGTCGAAGAATGATGTATT TAAATTACGATCTGTTAATAACATAGTAATAGCTCCGGCTAGTACTGGTAATGATAATAAT AATAGAATTGCTGTAATTACTACAGATCAAACAAATAAGGGCATTCGGTCAAGAGTAATT CCAGTGGATCGTATATTAATTACTGTTGTAATAAAATTTACTGCCCCTAAAATTGATGAAATA CCGGCAAGATGTAAAGAAAAAATAGCTAAATCAACAGAGGCACCACCATGAGCAATACCT GCAGACAGA

Description

Male

MEASUREMENTS. Body: 2–2.1 mm long; wing: 2.1–2.4 mm long.

HEAD. Face narrow, parallel-sided, a little wider than postpedicel. Antenna uniformly brown. Postpedicel almost 6 × (5.8) as long as wide; arista short (a third of the length of the postpedicel); basal aristal segment short. Palpus yellowish, with a small pale brown bristle. Vertical bristles twice as long as ocellars. Postoculars all whitish, uniseriate above, multiseriate and densely set below.

THORAX. Acrostichals short, biseriate, rows close together, present on basal ⅔ of mesonotum. Five long dorsocentrals equally long, with a short bristle in front. A pair of long scutellars.

LEGS. Yellow, but base of fore coxa brown, mid and hind coxae anteriorly brownish, hind leg with knee brown (tip of femur and base of tibia). Fore tarsus with tarsomeres 2–4 brown above, apical tarsomere entirely brown. Mid and hind leg with only tarsomeres 4 and 5 brown.

FORE LEG. Coxa with long pale bristles ( Fig. 3 ). Femur with three preapical posteroventral bristles. Tibia with a long dorsal preapical and a ventral row of bristles, nearly as long as tibia is wide. Tarsomere 1 with a ventral row of bristly hairs ( Fig. 4A ); its tip is ventrally not produced and bears a pair of curved apical spines.

MID LEG. Coxa with white bristles anteriorly and a white exterior. Femur with a preapical anterior, one preapical posteroventral and two distinct posteriors. Tibia with two short ad and an apical crown of short bristles.

HIND LEG. Coxa with a white exterior bristle. Tibia with a short ad and pd in basal third and a short ad and pd in apical third; apical crown with short bristles.

WING. Brownish tinged with brown veins ( Fig. 3 ). Squama white with long white cilia. Haltere white.

ABDOMEN. Same colouration as thorax, venter paler, with minute hairs. Only tergite 1 with long marginal bristles.

MALE TERMINALIA ( Fig. 4 ). Surstylus dark brown, with a pointed tip ( Figs 3 , 4C ). Cercus whitish, very long and thin, its tip reaching beyond tip of sternite 3.

Female

MEASUREMENTS. Larger than male. Body: 2.5–2.6 mm long; wing 2.3–2.6 mm long.

HEAD. Face parallel-sided, wide, nearly 4 × as wide as postpedicel. Scape and pedicel brown (not so dark as postpedicel); postpedicel black, elongate triangular, shorter than in male, 4–4.5 × as long as wide, about 1.5 × as long as arista.

LEGS. Fore coxa with long white bristles over entire posterior margin (shorter in male). Bristles of posteroventral row in apical half of fore tibia less distinct than in male. Fore tarsomere 1 without apical spines.

Remarks

See under R. hongkongense sp. nov. for characters distinguishing this species from Rhaphium outside of Hong Kong. Rhaphium spinulatum sp. nov. is smaller than R. hongkongense sp. nov. The basal aristal segment is longer. The tip of fore tarsomere 1 is not produced but bears a pair of distinct apical spinules. Coxae 2 and 3 both bear a white exterior bristle. The surstylus is black, with a slender, pointed tip.

Discussion of the systematic position

Rhaphium hongkongense sp. nov. and R. spinulatum sp. nov. both have a long postpedicel, respectively 5 and 6 × as long as wide, a simple arista, 5 dc, and a simple long elongate cercus not bifurcate and lacking a bundle of apical bristles.

Tang et al. (2016) and Qilemoge et al. (2019) give an overview of the attempts to classify the species of Rhaphium into species groups ( Naglis 2009; Naglis & Grootaert 2011; Negrobov & Grichanov 2010). Rhaphium hongkongense sp. nov. and R. spinulatum sp. nov. are close to the R. bilobum group, defined by Tang et al. (2016) in having the postpedicel of the antenna at least 6 × as long as wide, the arista as long as the width of the postpedicel, and 5 dc. However, in species of this group, the cercus of the male genitalia is bi-foliate, with two simple lobes, whereas R. hongkongense sp. nov. and R. spinulatum sp. nov. have simple cerci.

The two new species are more plausibly classified in the R. crassipes group sensu Negrobov & Grichanov (2010), which they resemble in the basic structure of the surstylus, epandrial lobe and cercus, though they differ from other species of the group, which have the male tarsomeres 4 and 5 of the mid leg black, dilated and dorsoventrally flattened. Despite this last distinction, R. hongkongense sp. nov. and R. spinulatum sp. nov. are very similar in the structure of the male terminalia to R. johnrichardi Negrobov & Grichanov, 2010 , described from the Sikhote Alin reserve in Promorsky Krai (Far East Russia).

Figures

Fig. 3. Rhaphium spinulatum sp. nov., holotype, ♂, habitus (RBINS). Scale bar: 1 mm. (Photo credit Ms Camille Locatelli)

Fig. 4. Rhaphium spinulatum sp. nov., holotype, ♂ (RBINS). A. Fore leg, posterior view. B. Fore coxa. C. Epandrium, lateral view. D. Epandrium, ventral view. E. Epandrium with cerci, ventral view. Scale bars: 0.1 mm.