Mycosocceriaceae Tedersoo, Bahram & Esmaeilzadeh-Salestani, 2025

Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin & Nilsson, R. Henrik, 2025, Thirty novel fungal lineages: formal description based on environmental samples and DNA, MycoKeys 124, pp. 1-121 : 1-121

Mycosocceriaceae Tedersoo, Bahram & Esmaeilzadeh-Salestani fam. nov.

Type genus.

Mycosocceria Tedersoo, Bahram & Esmaeilzadeh-Salestani .

Diagnosis.

Distinguishable from other species of Mortierellomycetes based on diagnostic nucleotide signatures in SSU V 9 (positions 1654–1663 in S. cerevisiae gattgaacgg; no mismatch allowed), 5.8S (positions 90–99 in type species and S. cerevisiae tcatcaaatc; no mismatch allowed), and LSU D 2 (positions 573–592 in type species and 521–540 in S. cerevisiae aagttggaggaatgtggctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Mycosocceriales , covering sequences EUK 0531595 , EUK 1102426 , EUK 1202279 , EUK 0531631 , EUK 1008618 , and EUK 1124462 (Fig. 1 ).

Notes.

Recognized based on eDNA sequences only. Currently includes Mycosocceria (gen. nov.) and other potentially genus-level groups represented by sequences EUK 1102426 (forest soil in Puerto Rico), EUK 0531595 (orchard soil in Estonia), and EUK 1202279 (forest soil in Italy).

Figures

Figure 1. Maximum Likelihood SSU- 5.8 S-LSU phylogram indicating placement of novel lineages in the fungal kingdom as highlighted in a coloured shade and red font. Previously described taxonomic clades are collapsed. All branches of Sumavosporidiomycetes and Gelotisporidiomycetes are shortened two-fold. Poorly supported branches with bootstrap values below 95 % / 99 % are indicated in blue. The original tree with bootstrap values and uncollapsed branches is indicated in Suppl. material 1.