taxonID	type	description	language	source
4D7E87DA4B79720EFF4DFF20ADE2FC15.taxon	discussion	We proposed to treat Chlosyne flavula (W. Barnes & McDunnough, 1918) (type locality USA: Colorado, Garfield Co., Glenwood Springs) as a species distinct from Chlosyne palla (Boisduval, 1852) (type locality in USA: California, Plumas Co.) based on notable genetic differentiation and limited gene exchange between these two taxa (Zhang et al. 2023 d). However, the ultimate evidence of distinction at the species level comes from finding two taxa in sympatry. Genomic sequencing of additional specimens from the Pacific Northwest reveals that the two species may be sympatric in Osoyoos, British Columbia, Canada, where a specimen of Chlosyne flavula blackmorei Pelham, 2008 (type locality Canada: British Columbia, Lytton) (NVG- 24014 H 10, Fig. 1 a) and a specimen of Chlosyne palla sterope (W. H. Edwards, 1870) (type locality in USA: Oregon, Wasco Co.) (NVG- 24015 A 09, Fig. 1 b) were collected by J. K. Jacob five days apart. However, the locality “ Osoyoos ” specified on the labels may refer to a general area only. Thus, further genomic sequencing to include various localities, especially from Idaho, will shed more light on the question about the sympatry of C. palla and C. flavula. In the nuclear genomic tree, these two specimens from “ Osoyoos ” are placed in different clades corresponding to their species (Fig. 2 blue and red, highlighted yellow). Moreover, all additional specimens we sequenced are confidently attributed to their distinct clades by species and, within each species clade, by subspecies and their localities. Species clades are supported by bootstrap values of 100 %, and no hybrids are observed. These additional results confirm that Melitaea sterope is a subspecies of C. palla and not of Chlosyne acastus (W. H. Edwards, 1874) (type locality in USA: Utah, probably Utah Co.) (Zhang et al. 2022 c), and that C. flavula is a species distinct from C. palla.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B777200FF2DFF14AC77FD21.taxon	discussion	Nuclear genome phylogeny reveals that Erebia (Erebia) theano (Tauscher, 1806) (type locality in Altai Mts.) (Fig. 3 a brown), Erebia (Erebia) stubbendorfii Ménétriés, 1847 (type locality Russia: Kansk) (Fig. 3 a olive), and Erebia (Erebia) pawloskii Ménétriés, 1859 (type locality in Russia: Sakha) (Fig. 3 a purple, blue, magenta, green, dark blue, and cyan, with the nominate in blue), form strongly supported (100 % ultrafast bootstrap (Minh et al. 2013 )) clades genetically differentiated at the species level, e. g., their Fst values are: 0.36 (E. theano and E. stubbendorfii), 0.36 (E. theano and E. pawloskii), and 0.28 (E. stubbendorfii and E. pawloskii). Therefore, genomic analysis supports the three distinct species hypothesis (Lukhtanov and Lukhtanov 1994; Gorbunov 2001) and suggests that the name stubbendorfii should not be applied to E. pawloskii. Curiously, mitochondrial genome phylogeny is different, and reveals two major haplotypes for these species, split by geography: the Old World haplotype (including the North Slope of Alaska, USA) and the New World haplotype (the rest of Alaska, Canada, and the US) (Fig. 3 b). Similar evolutionary scenarios, likely resulting from mitochondrial introgression, are known in other butterfly groups, such as Junonia Hübner, [1819] (Gemmell and Marcus 2015), and offer a cautionary lesson against relying solely on mitochondrial data (e. g., COI barcodes) to address species delimitation.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B767201FE98FFFEAB7FFE0F.taxon	description	Originally proposed as a subspecies of Erebia (Erebia) theano (Tauscher, 1806) (type locality in Altai Mts.), and currently treated as a subspecies of Erebia (Erebia) pawloskii Ménétriés, 1859 (type locality in Russia: Sakha), Erebia theano demmia Warren, 1936 (type locality in USA: Colorado, San Juan Mountains) is genetically differentiated from them at the species level (Fig. 3 a red), e. g., Fst / Gmin statistics for the phylogenetically closest pair (E. theano demmia and E. pawloskii) are 0.34 / 0.015. Therefore, we propose that Erebia (Erebia) demmia B. Warren, 1936, stat. nov. is a species distinct from Erebia (Erebia) pawloskii Ménétriés, 1859.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B767201FF2BFE6CAC0AFD26.taxon	discussion	At times, synonymized with Erebia (Erebia) pawloskii pawloskii Ménétriés, 1859 (type locality in Russia: Sakha), Erebia pawlowskyi [sic] var. sajana Staudinger, 1894 (type locality in Russia: Buryatia, East Sayan) forms a distinct clade in both genomic trees (Fig. 3 purple) genetically differentiated from others at the subspecies level (e. g., Fig. 3 purple vs. blue). Therefore, we treat Erebia (Erebia) pawloskii sajana Staudinger, 1894, stat. rest. as a valid subspecies, not a synonym of E. pawloskii pawloskii.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B767202FEFBFC80AA83FC05.taxon	description	http: // zoobank. org / 79 EA 8344 - F 03 A- 4 D 4 C-A 7 D 4 - F 3095814 D 506 (Figs. 3 part, 4)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B767202FEFBFC80AA83FC05.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Erebia (Erebia) pawloskii Ménétriés, 1859 (type locality in Russia: Sakha) specimens reveals a clade of a pair from Chukotka, Russia, not monophyletic with any represents a new subspecies. It differs by smaller orange and cream spots than in most other subspecies (except the two mentioned next), the spots are vestigial in the posterior 2 / 3 rd of the hindwing of a male, but larger ventral hindwing cream spots than in Erebia pawloskii alaskensis W. Holland, 1900 (type locality in USA: Alaska) and Erebia pawloskii canadensis B. Warren, 1931 (type locality in Canada: Manitoba). Due to unexplored individual variation in this subspecies, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: hm 2021401 - RA. 2: C 36 T, hm 2021401 - RA. 2: T 87 C, hm 2004829 - RA. 3: C 54 T, hm 2007306 - RA. 8: A 114 G, hm 2018041 - RA. 1: A 456 G. However, this taxon does not differ from other subspecies and even related species in the COI barcode because the mitochondrial genome seems to introgress among the relatives (Fig. 3 b). Barcode sequence of the holotype. Sample NVG- 24041 B 06, GenBank PV 549978, 658 base pairs: AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGTACATCTCTCAGTTTAATTATTCGAACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGTAATTGACTTATTCCTATTATATTAGGAGCCCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGACTCCTTCCCCCCTCTTTAATTTTATTAATTTCAAGTAGTATTGTAGAAAATGGTGCTGGTACAGGATGAACGGTTTATCCCCCCCTTTCATCTAATATTGC TCACAGTGGATCTTCTGTTGATTTAGCAATTTTCTCTTTACATTTAGCTGGAATTTCATCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGTATATCT TATGATCAAATACCATTATTTGTTTGAGCTGTTGGAATTACAGCATTATTATTATTACTCTCTCTACCTGTATTAGCTGGAGCTATTACAATACTTCTTACAGATCGAAATTTAAACACCT CTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B767202FEFBFC80AA83FC05.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Staatliches Museum für Naturkunde, Stuttgart, Germany (SMNS), illustrated in Fig. 4 a, bears the following four printed rectangular labels, three white: [Russland, E. - Sibiria | Chukotka, Bilibino | VII. 1993 | leg. Karpov], [ex coll. W. Eckweiler | SMNS-Lep. 2005 – 07], [DNA sample ID: | NVG- 24041 B 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Erebia pawloskii | bilibinia Grishin]. Paratype: 1 ♀ NVG- 24041 B 07 the same data as the holotype (Fig. 4 b). Type locality. Russia: Chukotka, Bilibino.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B767202FEFBFC80AA83FC05.taxon	etymology	Etymology. The name is given for the type locality and is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B767202FEFBFC80AA83FC05.taxon	distribution	Distribution. Currently known only from Chukotka in Russia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B757203FE9CFBC8ADE7FF6C.taxon	discussion	Genomic analysis of Dodona Hewitson, 1861 (type species Melitaea durga Kollar, 1844) reveals that the genus partitions into four prominent clades genetically differentiated at the subgenus level (Fig. 5). One of these clades corresponds to Balonca F. Moore, 1901 (type species Dodona deodata Hewitson, 1876), currently regarded as a junior subjective synonym of Dodona. Dodona and Balonca type species differ by 6.8 % (45 bp) in their COI barcodes. Therefore, we propose to treat Balonca F. Moore, 1901, stat. nov. as a subgenus of Dodona Hewitson, 1861. The two other clades do not include type species of any available genus group names and, therefore, correspond to the new subgenera described below.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDA2FC62ABC9F873.taxon	description	http: // zoobank. org / BFF 752 DF-DA 63 - 4043 - 91 F 6 - 34 E 579 F 956 F 8	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDA2FC62ABC9F873.taxon	type_taxon	Type species. Taxila egeon Westwood, 1851.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDA2FC62ABC9F873.taxon	description	Definition. This is the second new subgenus of Dodona Hewitson, 1861 (type species Melitaea durga Kollar, 1844) (see above for discussions) (Fig. 5 green) that is sister to the nominal subgenus (Fig. 5 magenta). COI barcodes between these sister taxa differ by 7.3 % (48 bp). This new subgenus differs from its relatives by the following combination of characters: the phallus is usually longer and stronger curved, the phallobase is straighter and the connection between the phallus and phallobase is less bent; males have brown wings with orange spots and stripes above (four stripes on the forewing: the apical stripe — which is sometimes vestigial — not merged with the submarginal stripe) but without white areas and stripes characteristics of Balonca and with wings and orange spots less round and spots less uniform than in the subgenus Dodona, and differs from several similar-looking species of Balonca either by more extensive orange coloration, especially of the ventral side, or by not having brown framing on the basal side of pale hindwing streaks. For genitalia illustrations of some representative species in the new subgenus, see Wu et al. (2018). In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 3991.3.1: T 363 C, cne 3991.3.1: T 384 C, cne 9860.2.4: C 37 T, cne 1134.1.1: A 336 G, cne 3461.1.15: C 2524 A; and in COI barcode: T 127 A or T 463 C, A 202 C or T 206 C, T 479 T, T 484 T, T 571 C or T 574 A, T 533 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDA2FC62ABC9F873.taxon	etymology	Etymology. The name is formed from the name of the type species and is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDA2FC62ABC9F873.taxon	discussion	Parent taxon. Genus Dodona Hewitson, 1861.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDDEFF4AABC9FC01.taxon	description	http: // zoobank. org / 54 C 8 B 894 - E 6 E 2 - 443 F- 9 C 01 - 2 C 6 A 367 B 5 CFC	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDDEFF4AABC9FC01.taxon	type_taxon	Type species. Dodona ouida Hewitson, 1866.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDDEFF4AABC9FC01.taxon	description	Definition. Genome-based phylogeny reveals that Dodona Hewitson, 1861 (type species Melitaea durga Kollar, 1844) splits into four clades that we define as subgenera (Fig. 5). Two of them have names: Dodona, which consists of only the type species, and Balonca F. Moore, 1901 (type species Dodona deodata Hewitson, 1876), which includes all other species not placed in the two new subgenera. The clade with Dodona ouida Hewitson, 1866 (type locality in India: Darjeeling) (Fig. 5 red) is sister to all other Dodona species and represents the first new subgenus. This new subgenus differs from its relatives by the following combination of characters: brown wings with three (not four) continuous orange stripes on the forewing (submarginal, discal, and basal) in males, and a single cream forewing discal band in females; and the ventral hindwing having a black spot by the costa in the middle with a white spot distad merged with it. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 246.3.1: A 1743 G, cne 792.27.11: G 1335 C, cne 14967.2.1: A 330 T, cne 14967.2.1: T 342 C, cne 14967.2.1: C 358 A; and in COI barcode: A 31 T, T 59 C, A 79 T, T 364 C, A 469 T, 499 A (not T).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDDEFF4AABC9FC01.taxon	etymology	Etymology. The name of the subgenus is tautonymous with its type species name and is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B747203FDDEFF4AABC9FC01.taxon	discussion	Parent taxon. Genus Dodona Hewitson, 1861.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B737205FDA9FFFEACF3F872.taxon	description	http: // zoobank. org / 83817 CD 8 - BC 22 - 4 AA 1 - BF 5 C- 7 F 07 CA 4 DF 9 D 7 (Figs. 6 part, 7, 8 b)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B737205FDA9FFFEACF3F872.taxon	diagnosis	Definition and diagnosis. Nuclear genome analysis of Lasaia H. Bates, 1868 (type species Papilio meris Stoll, 1781) reveals a clade (Fig. 6 a red) that is sister to both Lasaia sula Staudinger, 1888 (type locality in Honduras) (Fig. 6 blue) and Lasaia peninsularis Clench, 1972 (type locality in Mexico: Veracruz) (Fig. 6 a purple), thus representing a new species. The three species (the new one, L. sula, and L. peninsularis) are genetically differentiated from each other to a similar degree in the nuclear genome (Fig. 6 a) (Fst 0.37 and 0.44 between the new one and L. sula and L. peninsularis, respectively) but do not strongly differ in the mitochondrial genome (Fig. 6 b) and, consequently, also in the COI barcode. The new species differs from its relatives by males having better developed dark spots and dashes, the hindwing with stronger developed dark dashes, similarly to the forewing (weaker than on the forewing or absent dashes in both L. sula and L. peninsularis), and some specimens having less blue above, greyer, thus somewhat resembling Lasaia maria maria Clench, 1972 (type locality in Mexico: Jalisco) and Lasaia sessilis Schaus, 1890 (type locality in Mexico: Veracruz), but are paler and patterned more like L. sula. In male genitalia (Fig. 8), the transtilla (McAlpine 1971) is pointed in the middle as in L. peninsularis and not flattened as in L. sula (Fig. 8 green arrow 1); lateral lobes of the transtilla are narrower than in L. sula and are more similar to L. peninsularis (Fig. 8 green arrow 2), if not smaller; and the scobinate bulla (Clench 1972) (Fig. 8 green arrow 3) is more robust than in the other two species. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 2812.5.8: A 69 T, cne 28857.1.4: G 42 A, cne 28857.1.4: A 65 G, cne 8137.3.6: C 54 T, cne 8137.3.6: C 66 T. The COI barcode does not differ for L. sula. Barcode sequence of the holotype. Sample NVG- 23103 F 05, GenBank PV 549979, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCATTAAGTTTATTAATTCGTATAGAATTAGGTATACCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCATCTTTATTTCTATTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGAACTGGTTGAACAGTTTATCCCCCTTTATCTTCTAATATTGC CCACGGAGGATCCTCAGTAGATTTAGCTATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTTTAGGAGCCATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTCGTATGATCCGTTGGTATTACTGCTTTATTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACAT CTTTTTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B737205FDA9FFFEACF3F872.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 7, bears the following four rectangular labels (1 st handwritten, others printed), three white: [MEXICO: Colima | Comala 2100 ft. | 1. X. 1967 | R. G. Wind], [R. G. Wind, leg. | Gift of F. M. Brown | C. M. Acc. 23123], [DNA sample ID: | NVG- 23111 F 10 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Lasaia cola | Grishin]. Paratypes: 2 ♂♂ and 1 ♀ from Mexico, Colima: 1 ♂ NVG- 24079 H 06 (leg DNA extraction, sequenced), NVG- 25014 D 03 (abdomen DNA extraction and dissection) La Salada, 1000 ft, 4 - Jan- 1968, Robert G. Wind leg., genitalia NVG 250517 - 02 (Fig. 8 b) [MGCL] and (no locality details) [SMF]: 1 ♂ NVG- 23103 F 05 May- 1918 and 1 ♀ NVG- 23103 F 06 Oct- 1926. Type locality. Mexico: Colima, Comala, elevation 2100 ft.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B737205FDA9FFFEACF3F872.taxon	etymology	Etymology. The name is formed from the type locality in Col [im] a and is a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B737205FDA9FFFEACF3F872.taxon	distribution	Distribution. Currently known only from Colima in Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B737205FDA9FFFEACF3F872.taxon	discussion	Comment. In Lasaia, valvae are partly (and weakly) sclerotized and are flexible, semi-transparent side flaps (with sparse setae) on the sides of the scobinate bulla (Clench 1972), as seen in Fig. 8 a, ventral view.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B717206FE1EFD56AD39FADB.taxon	discussion	Lasaia sessilis oaxacensis Grishin, 2024 (type locality in Mexico: Oaxaca) was described from a single specimen that was distinct from but closely related to Lasaia sessilis Schaus, 1890 (type locality in Mexico: Veracruz, Coatepec, syntype sequenced as NVG- 18048 A 05). We found and sequenced two more specimens of L. sessilis oaxacensis and were able to carry out more detailed genomic comparison between this taxon and the nominate subspecies (Fig. 9), leading to Fst (genetic differentiation) and Gmin (introgression) statistics (computed on the Z chromosome) of 0.42 and 0.01, respectively. These numbers are in better agreement with species-level differences between the two taxa. Sequenced specimens of L. sessilis sessilis from distant localities from Mexico (San Luis Potosí and Veracruz) to Costa Rica cluster very closely with each other in genomic trees (Fig. 9 blue) and are more distant from L. sessilis oaxacensis. Moreover, the genetic differentiation in the Z chromosome is larger between L. sessilis sessilis and L. sessilis oaxacensis (Fig. 9 a blue and red) than between the two species, Lasaia moeros Staudinger, 1888 (type locality in Peru: Chanchamayo) and Lasaia kennethi Weeks, 1901 (type locality in Bolivia) (Fig. 9 a purple and green). For all these reasons, we propose that Lasaia oaxacensis Grishin, 2024, stat. nov. is a species distinct from Lasaia sessilis Schaus, 1890.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B717207FDDFFAC4ABECFBA3.taxon	description	http: // zoobank. org / F 0535 E 1 E-FBA 7 - 45 EC-AFA 8 - 345 BD 6 BC 7 C 75	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B717207FDDFFAC4ABECFBA3.taxon	type_taxon	Type species. Lasaia oileus Godman, 1903.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B717207FDDFFAC4ABECFBA3.taxon	description	Definition. Genomic phylogeny of Lasaia Bates, 1868 (type species Papilio meris Stoll, 1781) reveals that Lasaia oileus Godman, 1903 (type locality in Paraguay) (Fig. 10 red) is sister to all other species and is strongly differentiated from them genetically at the subgenus level (Fig. 10 blue vs. red); e. g., their COI barcodes differ by 7.4 – 8.4 % (49 – 55 bp) and, therefore, the clade with L. oileus represents a new subgenus. This new subgenus keys to 10 a in the Lasaia key of Clench (1972) and corresponds, in part, to the “ E. oileus group ” of Clench inherited from the “ Cohort 3. Oileiformis ” of Stichel (1910 - 1911), who described its phenotypic characters in detail, first, for the genus Lasaia, and second for “ Oileiformis ”, which he has not proposed a genus group name for, but characterized as “ ground color of the wings above in both sexes blackish or brown, ” in contrast to bluish, greenish, or grayish tones in males of other Lasaia. To this definition, the following should be added: smaller size than its congeners; white spots in several cells by the forewing costa about 2 / 3 from the base and pale submarginal overscaling on the hindwing above between dark-brown spots and dots; and prominent white segments on the fringes, particularly on the hindwing. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 657.9.2: A 465 C, cne 8314.8.1: A 224 G, cne 7888.2.6: G 30 A, cne 5774.10.1: T 414 C, cne 5774.10.1: T 426 A; and in COI barcode: A 22 T, T 121 A, T 418 C, T 374 G, A 625 T, A 637 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B717207FDDFFAC4ABECFBA3.taxon	etymology	Etymology. Oileus (Ὀϊλεύς) was the king of Locris, a region in ancient Greece. The name is a masculine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B717207FDDFFAC4ABECFBA3.taxon	discussion	Species included. Only the type species (i. e., Lasaia oileus Godman, 1903). Parent taxon. Genus Lasaia H. Bates, 1868.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B707207FF72FB0FAD80F9DB.taxon	discussion	Genomic analysis of Curvie Grishin, 2019 (type species Symmachia emesia Hewitson, 1867) reveals that the genus consists of five species-level taxa (Fig. 11 different colors). Symmachia yucatanensis Godman & Salvin, 1886 (type locality in Mexico, Yucatán) is currently treated as a junior subjective synonym of Curvie emesia (Hewitson, 1867) (type locality in Nicaragua). However, the two taxa are genetically differentiated at the species level (Fig. 11 purple and blue), i. e., their COI barcodes differ by 2.3 % (15 bp). Therefore, we propose that Curvie yucatanensis (Godman & Salvin, 1886), stat. rest. is a valid species distinct from Curvie emesia (Hewitson, 1867). In addition to these two species in the genus Curvie, three species do not have available names and are described below as new.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B70721AFDB2F9C0AD4AFD79.taxon	description	http: // zoobank. org / AA 5 E 15 EB-F 2 B 5 - 4675 - 8311 - B 776 FC 204789 (Figs. 11 part, 12, 13 a)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B70721AFDB2F9C0AD4AFD79.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 12 a, bears the following three printed rectangular labels, two white: [USA: TEXAS: Hidalgo Co. | 2 air mi SE of Relampago | Old Rio Rico Rd., ex larva | GPS: 26.0667 °, - 97.8837 ° | larva collected 13 - Jun- 2015 | on Caesalpinia mexicana, adult ecl. | 4 - Jul- 2015, Grishin N. V. leg.], [DNA sample ID: | NVG- 24103 D 07 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Curvie wing | Grishin]. Paratypes: 18 ♂♂ and 16 ♀♀ in total: 8 ♂♂ and 7 ♀♀ data as the holotype except as stated: 1 ♂ NVG- 3479 30 - May, 2 ♂♂ NVG- 3759 and NVG- 3762 27 - Jun, and ex larvae, found and reared on leaves of Erythrostemon mexicanus (Gray 1861) Gagnon & Lewis 2016, eclosed on: 1 ♀ 11 - Jun, 1 ♂ and 1 ♀ NVG- 24103 D 08 (Fig. 12 b) 12 - Jun, 2 ♀♀ 27 - Jun, 1 ♀ 29 - Jun, 1 ♂ 2 - Jul, 1 ♂ 6 - Jul, 1 ♂ and 1 ♀ 8 - Jul, 1 ♀ 11 - Jul, and 1 ♂ 13 - Jul; USA, Texas, Hidalgo Co., N. V. Grishin leg.: 1 ♀ Weslaco, 26 - Nov- 2004 and 1 ♀ NVG- 5245 Los Ebanos, 26.24259, − 98.56121, 25 - Nov- 2015; and Mexico: Tamaulipas: nr. El Abra, Paso del Abra, ex ova on E. mexicanus, Roy O. Kendall & C. A. Kendall leg. [TAMU]: 1 ♂ NVG- 11913 15 - Feb- 1974, genitalia NVG 190113 - 23 and 1 ♀ NVG- 11914 16 - Feb- 1974, genitalia NVG 190113 - 24; Clench & Miller leg. [CMNH]: 1 ♂ NVG- 23112 B 11 0 - 3 mi NW Gomez Farias, 9 - Jan- 1966 and 1 ♂ NVG- 23112 B 10 9 mi W Soto la Marina, 8 - Jan- 1966, genitalia NVG 240817 - 05 (Fig. 13 a); and Ciudad Victoria: 1 ♂ NVG- 23112 B 12, 16 - Aug- 1962, H. A. Freeman leg. [CMNH] and Rio San Marcos, John Kemner leg. [MGCL]: 1 ♂ NVG- 24087 D 03, 1 - Jan- 1987 and 1 ♀ NVG- 24087 D 05, 29 - Nov- 1986; Nuevo Leon: Cola de Caballo: Roy O. Kendall & C. A. Kendall leg., [TAMU]: 1 ♂ NVG- 11911 25 - Oct- 1979, genitalia NVG 190113 - 21 and 1 ♀ NVG- 11912 23 - Oct- 1979, genitalia NVG 190113 - 22 and 1 ♀ NVG- 24087 C 12 19 - Jun- 1986, I. L. Finkelstein leg. [MGCL]; 1 ♀ NVG- 19044 E 12, AMNH _ IZC 00338007 Hacienda Vista Hermosa, Ville Santiago, 20 - Jun- 1940, Hoogstraal & Knight leg. [AMNH]; and 1 ♂ NVG- 24087 C 11 Raices, 8 - Jul- 1986, John Kemner leg. [MGCL]; San Luis Potosí: Ciudad Valles: H. A. Freeman leg. [CMNH]: 1 ♂ NVG- 23112 B 08 3 - Aug- 1956 and 1 ♀ NVG- 23112 B 09 16 - Jul- 1970; 1 ♂ NVG- 24087 D 06 Hwy 70, 22 km W of Ciudad Valles, 17 - Oct- 1984, H. D. Baggett leg. [MGCL]; and 1 ♀ NVG- 24087 D 07 Hwy 85, ca. 15 mi S Ciudad Valles, 22 - Jun- 1986, I. L. Finkelstein leg. [MGCL]; and 1 ♂ NVG- 19044 E 11, AMNH _ IZC 00338006 Veracruz, Jalapa, old [AMNH]. Type locality. USA: Texas, Hidalgo Co., 2 air mi southeast of Relampago, Old Rio Rico Road, GPS 26.0667, − 97.8837.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B70721AFDB2F9C0AD4AFD79.taxon	etymology	Etymology. The name is inspired by the English name “ Curve-winged Metalmark ” applied to this species in the U. S. and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B70721AFDB2F9C0AD4AFD79.taxon	distribution	Distribution. From South Texas, USA, through eastern Mexico to Veracruz.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6D721BFD93FD6DAD2AFBAA.taxon	description	http: // zoobank. org / B 18 E 8 D 86 - 2 A 4 B- 46 E 3 - A 2 E 0 - 05137076 A 417 (Figs. 11 part, 13 b – c, 14)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6D721BFD93FD6DAD2AFBAA.taxon	etymology	Etymology. The name indicates a more western distribution of this sister to C. wing sp. n. and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6D721BFD93FD6DAD2AFBAA.taxon	distribution	Distribution. Western and southern Mexico, from Sonora to Oaxaca.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6C721CFD99FB39AA8AFA25.taxon	description	http: // zoobank. org / 99 F 3 F 7 E 6 - AB 3 D- 4 C 04 - AD 4 E-A 44 E 87 FCA 079 (Figs. 11 part, 15)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6C721CFD99FB39AA8AFA25.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 15 a, bears the following four printed (text in italics handwritten) rectangular labels, three white: [T. Escalante | Las Delicias | Chis-VII- 69], [A. C. Allyn | Acc. 1973 – 48], [DNA sample ID: | NVG- 23116 C 07 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Curvie chiapensis | Grishin]. Paratype: 1 ♀ NVG- 23116 C 08 Mexico, Chiapas, Santa Rosa Comitán, Apr- 1959, T. Escalante leg. [USNM] (Fig. 15 b). Type locality. Mexico: Chiapas, Las Delicias.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6C721CFD99FB39AA8AFA25.taxon	etymology	Etymology. The name is given for the type locality and is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6C721CFD99FB39AA8AFA25.taxon	distribution	Distribution. Currently known only from Chiapas in Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6B721EFE42F98CAD58FED3.taxon	description	http: // zoobank. org / D 9 E 4 D 5 FA- 6 B 75 - 48 AB- 972 E- 9 A 232 C 625376 (Figs. 16 part, 17)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6B721EFE42F98CAD58FED3.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 17, bears the following five rectangular labels (1 st handwritten, others printed), four white: [Argentinia | Rschus.], [Coll. | Staudinger], [DNA sample ID: | NVG- 24032 C 07 | c / o Nick V. Grishin], [{QR Code} MfN URI | http: // coll. mfn- | berlin. de / u / | 09 c 87 b], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | tinia Grishin]. Type locality. Argentina.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6B721EFE42F98CAD58FED3.taxon	etymology	Etymology. The name is given for the country with the type locality: [Argen] tin {i} a, and also hints at a small size of this species. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B6B721EFE42F98CAD58FED3.taxon	distribution	Distribution. Currently known only from the holotype collected in Argentina.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B69721FFE56FEC0AD48FF3C.taxon	description	http: // zoobank. org / DC 681 E 0 D- 9 AFE- 4559 - 9 B 1 E-B 9725 FD 12 AC 0 (Figs. 16 part, 18)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B69721FFE56FEC0AD48FF3C.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 18, bears the following five rectangular labels (1 st handwritten, others printed), four white: [Uruguay | Rschus.], [Coll. | Staudinger], [DNA sample ID: | NVG- 24032 D 02 | c / o Nick V. Grishin], [{QR Code} MfN URI | http: // coll. mfn- | berlin. de / u / | 0 a 0 d 27], and one red [HOLOTYPE ♂ | Emesis (Tenedia) | guaya Grishin]. Type locality. Uruguay.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B69721FFE56FEC0AD48FF3C.taxon	etymology	Etymology. The name is given for the country with the type locality: [Uru] guay + a, and also refers to a prominently defined wire-like meandering discal dark line on the ventral forewing (in Spanish, guaya may mean cable or wire). The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B69721FFE56FEC0AD48FF3C.taxon	distribution	Distribution. Currently known only from the holotype collected in Uruguay.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B687210FE22FEBEAA55FA92.taxon	description	http: // zoobank. org / 1 A 2 FE 025 - 11 D 5 - 4167 - A 28 C- 39 E 8452 FE 405 (Figs. 19 part, 20)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B687210FE22FEBEAA55FA92.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 20 a, bears the following five rectangular labels (3 rd handwritten and framed, others printed; 3 rd green, 5 th red, and others white): [Panama | Bugaba | e. c. H. Stichel], [3268], [aurimna Bsd.], [DNA sample ID: | NVG- 18053 H 09 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Emesis (Aphacitis) | bugaba Grishin]. The 2 nd label gives the specimen number in the Stichel collection. Paratype: 1 ♀ NVG- 24031 D 06 the same data as the holotype but Stichel collection number 3271 (Fig. 20 b). Type locality. Panama: Chiriquí Province, Bugaba.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B687210FE22FEBEAA55FA92.taxon	etymology	Etymology. The name is given for the type locality and is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B687210FE22FEBEAA55FA92.taxon	distribution	Distribution. Currently known only from western Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B677212FE67FA01A9E3FF6D.taxon	description	http: // zoobank. org / 00 AE 0604 - 72 AE- 4 E 6 D-B 0 DD- 663 BCC 892274 (Figs. 21 part, 22 a)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B677212FE67FA01A9E3FF6D.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Fig. 22 a, bears the following four rectangular labels (2 nd handwritten, others printed), three white: [Tarap. | Perú], [♀ Nymph. regulus F. | Peru *], [DNA sample ID: | NVG- 23087 C 05 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Synargis | rectanga Grishin]. Type locality. Peru: San Martin Region, Tarapoto.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B677212FE67FA01A9E3FF6D.taxon	etymology	Etymology. The name is given for the rectangular shape of a wide cream-colored discal band and its brown frame, and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B677212FE67FA01A9E3FF6D.taxon	distribution	Distribution. Currently known only from the holotype collected in the lower eastern Andes of Northern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B657213FDB6FF4BABCBFE92.taxon	description	http: // zoobank. org / EB 3 A 4 B 74 - 169 A- 4427 - BE 00 - 7 ADA 53 A 264 E 3	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B657213FDB6FF4BABCBFE92.taxon	type_taxon	Type species. Hesperia lucianus Fabricius, 1793.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B657213FDB6FF4BABCBFE92.taxon	description	Definition. Genomic analysis reveals that Parvospila J. Hall, 2018 (type species Papilio emylius Cramer, 1775) partitions into two prominent clades genetically differentiated at least at the subgenus level (Fig. 23); e. g., their COI barcodes may differ by as much as 12.1 % (80 bp). One of the clades includes the type species of Parvospila, and the other corresponds to a new genus group taxon that is conservatively proposed at the subspecies level. This new subgenus encompasses the lucianus group of Hall (2018), and the phenotypic characters and the description referring to this species group given by Hall apply to this subgenus. In brief, this new subgenus differs from its relatives by a combination of the following characters: absent submarginal white spots on the dorsal side of the wings, even near the apex; a more projecting distad ventral corner of the uncus in lateral view, a longer (but still short) saccus; narrower and upturned at the narrowing tip valvae; and a longer aedeagus with a cluster of much longer and prominent spines in vesica. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 2651.14.17: A 660 G, cne 2651.14.17: C 677 A, cne 96.1.3: G 91 C, cne 96.1.3: T 108 C, cne 4571.6.1: A 472 C; and in COI barcode: T 169 A, A 469 T, T 482 G, C 538 A, A 643 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B657213FDB6FF4BABCBFE92.taxon	etymology	Etymology. The name is a fusion of the type species and genus names: luci [anus] + [Parvo] spila. The name is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B657213FDB6FF4BABCBFE92.taxon	discussion	Species included. The type species (i. e., Hesperia lucianus Fabricius, 1793) and Echenais lucetia Hübner, 1821. Parent taxon. Genus Parvospila J. Hall, 2018.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647213FDD5FE19ABF5FABE.taxon	description	http: // zoobank. org / 858 E 778 D-D 277 - 4 FD 6 - 98 C 9 - 580 C 0 A 8 B 4 C 9 A	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647213FDD5FE19ABF5FABE.taxon	type_taxon	Type species. Lemonias byzeres Hewitson, 1872.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647213FDD5FE19ABF5FABE.taxon	description	Definition. Nuclear genome phylogeny reveals that Lemonias byzeres Hewitson, 1872 (type locality in Brazil: Pará) currently placed in the genus Pseudolivendula J. Hall, 2018 (type species Lemonias hemileuca Bates, 1868) is not monophyletic with its type species and instead is a confidently supported sister to Zelotaea H. Bates, 1868 (type species Zelotaea phasma Bates, 1868), genetically differentiated from Z. phasma at least at the subgenus level (Fig. 23); e. g., their COI barcodes differ by 10.6 % (70 bp). To restore monophyly and not willing to erect a new genus for L. byzeres and Nymphidium candace H. Druce, 1904 (type locality in Brazil: Rio de Janeiro), we transfer them to the genus Zelotaea as Zelotaea byzeres (Hewitson, 1872) comb. nov. and Zelotaea candace (H. Druce, 1904) comb. nov. The distinct lineage with Z. byzeres corresponds to a new genus group taxon that is conservatively proposed as a subgenus. This new subgenus encompasses the byzeres group of Hall (2018), and the phenotypic characters and the description referring to this species group given by Hall apply to this subgenus. In brief, this new subgenus differs from its relatives by a combination of the following characters: no white patch in the tornal half of the hindwing; a rufous-brown tone of dorsal wings in males; a more rectangular than triangular uncus in lateral view; a mostly straight to slightly concave dorsal margin of the valva; a narrowing to a sharp and slightly upturned point valva in lateral view; and fused cornuti. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 7747.1.11: A 78 T, cne 5623. 1.1: C 240 T, cne 2099.4.1: A 2067 G, cne 23345.2.2: C 136 T, cne 1842.8.1: T 304 C; and in COI barcode: A 44 T, 220 A, T 460 C, A 508 T, A 637 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647213FDD5FE19ABF5FABE.taxon	etymology	Etymology. The name is formed from the type species name and is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647213FDD5FE19ABF5FABE.taxon	discussion	Species included. The type species (i. e., Lemonias byzeres Hewitson, 1872) and Nymphidium candace H. Druce, 1904. Parent taxon. Genus Zelotaea H. Bates, 1868.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647214FD83FA24ABD9FD64.taxon	description	http: // zoobank. org / 039 B 5 F 09 - E 16 D- 4 BA 1 - 8243 - 689 F 19 CA 0085	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647214FD83FA24ABD9FD64.taxon	type_taxon	Type species. Apodemia ochracea Mengel, 1902.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647214FD83FA24ABD9FD64.taxon	description	Definition. Nuclear genome phylogeny reveals that Apodemia ochracea Mengel, 1902 (type locality in Paraguay), currently in the genus Lemonias Hübner, [1807] (type species Lemonias zygia Hübner, 1807), is not monophyletic with it and instead is sister to Aricoris Westwood, 1851 (type species Aricoris tisiphone Westwood, 1851, which is a junior subjective synonym of Erycina tutana Godart, [1824]), being genetically differentiated from it at the subgenus level (Fig. 23 purple and labeled orange); e. g., their COI barcodes differ by 9 % (59 bp). Therefore, we transfer Apodemia ochracea and phenotypically similar to it Riodina? theodora Godman, 1903, and Riodina? albofasciata Godman, 1903 from Lemonias to Aricoris forming Aricoris ochracea (Mengel, 1902), comb. nov., Aricoris theodora (Godman, 1903), comb. nov., and Aricoris albofasciata (Godman, 1903), comb. nov. Because the lineage with Aricoris ochracea does not contain type species of any available genus group names, it represents a new subgenus. This new subgenus differs from its relatives by the following combination of characters (see Hall and Harvey (2001) for illustrations and discussion): long falces, not shorter than the tegumen with the uncus; a uniformly broad uncus, not narrowing terminally in dorsal view and with a concave distal margin; a single spike-shaped cornutus in the vesica; the eights abdomen sternite in males is approximately rectangular, not narrowing terminally; the ductus bursae is compressed laterally towards the ostium bursae; the forewing costal margin in males is rather straight to slightly concave in the middle, and the outer margin is concave near the tornus; and wings are dark brown with orange and white bands, patches, and spots (one white spot is in the forewing discal cell). In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 1364.1.2: A 279 G, cne 1364.1.2: G 296 A, cne 13787.2.1: T 70 C, cne 13787. 2.1: A 84 G, cne 2068.2.1: A 4182 G; and in COI barcode: A 73 G, 139 C, T 304 C, T 532 A, A 541 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647214FD83FA24ABD9FD64.taxon	etymology	Etymology. This Aricoris is somewhat similar in wing patterns to some species of Chlosyne Butler, 1870 (Nymphalidae): Ari [coris] + Chlosyne. The name is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B647214FD83FA24ABD9FD64.taxon	discussion	Species included. The type species (i. e., Apodemia ochracea Mengel, 1902), Riodina? albofasciata Godman, 1903, and Riodina? theodora Godman, 1903. Parent taxon. Genus Aricoris Westwood, 1851.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B637214FF47FD49AB87FBFC.taxon	discussion	Currently treated as a genus, Ariconias J. Hall & Harvey, 2002 (type species Lemonias albinus C. Felder & R. Felder, 1861) is phenotypically similar (especially in wing shape) to the subgenus Arichlosyne subgen. n. (type species Apodemia ochracea Mengel, 1902) of Aricoris Westwood, 1851 (type species Aricoris tisiphone Westwood, 1851, which is a junior subjective synonym of Erycina tutana Godart, [1824]), and these genus group taxa are differentiated genetically from each other at the subgenus level (Fig. 23 purple); e. g., their COI barcodes differ by 8.5 % (56 bp) (Ariconias and Aricoris) and 8.7 % (57 bp) (Ariconias and Arichlosyne). Therefore, we propose that Ariconias J. Hall & Harvey, 2002 stat. nov. is a subgenus of Aricoris Westwood, 1851.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B637214FEB7FBE0AA77FA69.taxon	discussion	Currently treated as a genus, Thisbe Hübner, 1819 (type species Papilio belise Stoll, 1782, which is a junior subjective synonym of Papilio irenea Stoll, 1780) is genetically differentiated from Lemonias Hübner, [1807] (type species Lemonias zygia Hübner, 1807) at the subgenus level (Fig. 23 cyan); e. g., their COI barcodes differ by 8.4 % (55 bp). Therefore, we propose that Thisbe Hübner, 1819 stat. nov. is a subgenus of Lemonias Hübner, [1807]. Moreover, we find that Thisbe, as currently circumscribed, is not monophyletic (Fig. 23 red and cyan labeled in bright purple), and some species included in Thisbe belong to distinct genera, as elaborated upon in the next section.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B637214FD8FFA73A8D8F87D.taxon	discussion	Currently included within Thisbe Hübner, [1819] (type species Papilio belise Stoll, 1782, which is a junior subjective synonym of Papilio irenea Stoll, 1780), Uraneis Bates, 1868 (type species Tharops hyalina Butler, 1867) and Esthemopheles Röber, 1903 (type species Esthemopheles lamprolenis Röber, 1903, currently treated as a junior subjective synonym of Uraneis ucubis Hewitson, 1870) are not monophyletic with it, instead forming a clade (Fig. 23 red) sister to several genera (Fig. 23). To restore the monophyly, we propose that Uraneis Bates, 1868 stat. rest. is a valid genus and not a synonym of Thisbe Hübner, [1819]. The type species of Uraneis and Esthemopheles are closely related to each other (Fig. 23 red); e. g., their COI barcodes differ by 5.6 % (37 bp), and, therefore, we keep Esthemopheles Röber, 1903 as a junior subjective synonym, but place it in synonymy with Uraneis Bates, 1868 and not with Thisbe Hübner, [1819].	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FDDEFFFEAA2CFCBB.taxon	description	http: // zoobank. org / 3 D 0 DB 3 C 3 - 382 E- 4559 - 8 C 77 - 1698 E 6 A 854 D 3	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FDDEFFFEAA2CFCBB.taxon	type_taxon	Type species. Lemonias lencates Hewitson, 1875.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FDDEFFFEAA2CFCBB.taxon	description	Definition. Genomic phylogeny reveals that a clade of Pachythone H. Bates, 1868 (type species Pachythone erebia Bates, 1868) species formerly placed in Roeberella Strand, 1932 (type species Lemonias calvus Staudinger, 1887) (Fig. 23 labeled aquamarine) is genetically differentiated from the rest at least at the subgenus level, e. g., COI barcodes of Pachythone erebia and Pachythone lencates (Hewitson, 1875) differ by 10 % (66 bp). Therefore, this clade represents a new subgenus. This new subgenus differs from its relatives by the following combination of characters: forewings with a straight to slightly concave in the middle costal margin and a nearly hooked apex; wings are brown with darkerbrown spots and dashes, beneath paler and with whiter areas and stronger brown spotting with at least some dark spots framed with white; and a dorsal hindwing with white stripes and spots and at least with a predominantly white anal fold. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cne 9146.3.1: A 1335 C, cne 9146.3.1: C 1366 T, cne 81.7.1: G 66 A, cne 81.7.1: T 70 A, cne 10454.2. 3: A 303 T; and in COI barcode: A 88 T, T 220 C, T 281 C, T 349 A, T 475 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FDDEFFFEAA2CFCBB.taxon	etymology	Etymology. The name is formed from the type species and is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FDDEFFFEAA2CFCBB.taxon	discussion	Species included. The type species (i. e., Lemonias lencates Hewitson, 1875), Roeberella flocculus Brévignon & Gallard, 1993, Roeberella floccus Brévignon, 2013, Roeberella heberti P. Jauffret & J. Jauffret, 2007, and Roeberella marajoara P. Jauffret & J. Jauffret, 2007.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FDDEFFFEAA2CFCBB.taxon	description	Parent taxon. Genus Pachythone H. Bates, 1868.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FF51FC25A8C6FB2C.taxon	discussion	Currently treated as a genus, Pseudonymphidia Callaghan, 1985 (type species Emesis clearista Butler, 1871) includes species that are phenotypically similar to species in the subgenus Lenca subgen. n. (type species Lemonias lencates Hewitson, 1875) of Pachythone H. Bates, 1868 (type species Pachythone erebia Bates, 1868), and all these species are differentiated genetically from each other at the subgenus level (Fig. 23 blue), e. g., COI barcodes of the type species of Pseudonymphidia and Pachythone differ by 9 % (59 bp). Therefore, we propose that Pseudonymphidia Callaghan, 1985 stat. nov. is a subgenus of Pachythone H. Bates, 1868.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B627215FF2BFACCAC41F873.taxon	discussion	Genomic phylogeny reveals that Deudorix Hewitson, 1863 (type species Dipsas epijarbas F. Moore, 1858) is not monophyletic and species placed in this genus belong to four different clades (Fig. 24 blue, red, green, and magenta). The first is the clade with the type species of Deudorix, thus corresponding to this genus (Fig. 24 blue). This clade is sister to several genera that include Artipe Boisduval, 1870 (Papilio amyntor Herbst, 1804, a junior homonym, the valid name of this species is Papilio eryx Linnaeus, 1771) and Capys Hewitson, 1865 (type species Papilio alpheus Cramer, 1777). The second clade, which is not monophyletic with Deudorix, corresponds to the genus Virachola F. Moore, 1881 (type species Deudorix perse Hewitson, 1863) (Fig. 24 green), which at times is considered a valid genus (Rawlins et al. 2020). Thus, our phylogeny offers decisive evidence for treating Virachola F. Moore, 1881, stat. rest. as a genus distinct from Deudorix. However, Virachola is closely related to Artipe and could potentially be treated as its subgenus — a possibility we leave for future investigation. Furthermore, only Asian species are included in Virachola. African species form a clade that is sister to Capys, and we assign them to this genus within a newly described subgenus, detailed below. This new subgenus of Capys corresponds to the third clade of species currently in Deudorix (Fig. 24 magenta). The fourth clade is sister to all members of this group of several genera (Fig. 24 red) and it corresponds to a new genus that is described next.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B617217FDD6FFFEABD2FCD9.taxon	description	http: // zoobank. org / 5 E 009 C 8 E- 3 D 24 - 44 C 7 - BE 28 - D 1772045 AC 3 E	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B617217FDD6FFFEABD2FCD9.taxon	type_taxon	Type species. Rapala hypargyria Elwes, 1893.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B617217FDD6FFFEABD2FCD9.taxon	description	Definition. Genomic phylogeny reveals that several species placed in Deudorix Hewitson, 1863 (type species Dipsas epijarbas F. Moore, 1858) are not monophyletic with it and instead form a clade sister to several other genera, such as Bindahara F. Moore, 1881 (type species Hesperia phocides Fabricius, 1793) and Capys Hewitson, 1865 (type species Papilio alpheus Cramer, 1777), among others (Fig. 24 red), and, therefore, this clade corresponds to a new genus. This new genus differs from its relatives by having unusual for the group ventral wing patterns, i. e., instead of the typical grayish brown ground color with slightly darker bands framed with white lines separated into spots, species of the new genus are pearly gray with round brown spots, or creamy white with brown margins but without discal or postdiscal brown bands. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce 2070. 17.4: C 477 T, cce 303125.12.1: A 1164 T, cce 303125.12.1: T 1191 A, cce 8301.4.10: A 198 G, cce 8301.4.10: A 243 G; and COI barcode: A 22 T, A 46 T, A 298 T, A 316 T, A 370 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B617217FDD6FFFEABD2FCD9.taxon	etymology	Etymology. In Spanish, deudo means relative, and ajeno means outsider, stranger, alien, or not-fitting, reflecting that this new genus does not fit within Deudorix: Ajeno + [Deudo] rix. According to the genomic phylogeny, this genus is an “ outsider ” — that is, sister to the rest of the clade. The name is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B617217FDD6FFFEABD2FCD9.taxon	discussion	Species included. The type species (i. e., Rapala hypargyria Elwes, 1893), Deudorix apayao H. Schroeder & Treadaway, 1983, Deudorix cleora L. Miller & J. Miller, 1986, Deudorix novellus Yagishita, 2006, Deudorix philippinensis H. Schröder, Treadaway & Hayashi, 1981, and Deudorix toxopeusi Tennent, C. Müller & Rawlins, 2010. Parent taxon. Tribe Deudorigini Doherty, 1886.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B607228FDD7FCCFABE6FF1C.taxon	description	http: // zoobank. org / 0 EC 2 FE 69 - 362 B- 4 D 26 - BCAB- 33 E 037003 D 40	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B607228FDD7FCCFABE6FF1C.taxon	type_taxon	Type species. Dipsas antalus Hopffer, 1855.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B607228FDD7FCCFABE6FF1C.taxon	description	Definition. Genomic phylogeny reveals that African species currently placed in Deudorix Hewitson, 1863 (type species Dipsas epijarbas F. Moore, 1858) or Virachola F. Moore, 1881 (type species Deudorix perse Hewitson, 1863) are not monophyletic with these genera and instead form a clade sister to another African genus Capys Hewitson, 1865 (type species Papilio alpheus Cramer, 1777), being closely related to it (Fig. 24 purple and magenta); e. g., their COI barcodes differ by 4 % (26 bp). Accordingly, we assign these species to the genus Capys, but, in light of some genetic divergence and pronounced differences in wing shape and pattern, we recognize them as a distinct subgenus. This new subgenus corresponds to “ Virachola ” of Stempffer (1967) who summarized its morphological characters. In brief, the aedeagus is typically longer; falces are shorter and thicker, in many species with a small apophysis; valvae are bladeshaped, frequently shorter, and are fused from the base, in some species for nearly their entire length, and are either long and terminally pointed or appear irregularly truncated (Larsen 2005); the hindwing with a prominent tornal lobe and a hair-like tail; the ventral forewing with a hair tuft and the dorsal hindwing with a small androconial spot at the base; the ventral wing pattern is frequently with rounder spots framed or filled by reddish (instead of grayish) scales; the dorsal hindwing is nearly all orange in males of many species. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce 3319. 2.2: T 72 A, cce 3268.2.3: G 82 A, cce 2518.2.9: T 2032 C, cce 2518.2.9: A 2061 G, cce 18900.2.2: T 168 C; and COI barcode: T 38 T, T 304 C, 400 A, 514 T, T 547 A.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B607228FDD7FCCFABE6FF1C.taxon	etymology	Etymology. The name is a fusion of Af [rican] + [Deudo] rix, referring to the African distribution of this taxon. The name is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B607228FDD7FCCFABE6FF1C.taxon	discussion	Species included. The type species (i. e., Dipsas antalus Hopffer, 1855), Lycaena batikeli Boisduval, 1833, Deudorix caliginosa Lathy, 1903, Deudorix dariaves Hewitson, 1877, Deudorix dinochares Grose-Smith, 1887, Deudorix dinomenes Grose-Smith, 1887, Deudorix diocles Hewitson, [1869], Deudorix diopolis Hewitson, [1878], Deudorix (Virachola) ecaudata Gifford, 1963, Virachola? edwardsi Gabriel, 1939, Thecla galathea Swainson, [1821], Deudorix (Virachola) kayonza Stempffer, 1956, Lycaena livia Klug, [1834], Myrina lorisona Hewitson, [1863], Deudorix nicephora Hulstaert, 1924, Deudorix odana Druce, 1887, Hypolycaena renidens Mabille, 1884, Deudorix (Virachola) suk Stempffer, 1948, Virachola ufipa Kielland, 1978, Deudorix ungemachi Libert, 2004, Deudorix (Virachola) vansomereni Stempffer, 1951, and Deudorix vansoni Pennington, 1948. Parent taxon. Genus Capys Hewitson, 1865.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDCFB1DABD2F858.taxon	description	http: // zoobank. org / 9 EE 62 E 32 - 9133 - 4 B 8 B-A 664 - FA 552 E 1350 FF	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDCFB1DABD2F858.taxon	type_taxon	Type species. Hesperia isocrates Fabricius, 1793.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDCFB1DABD2F858.taxon	description	Definition. DNA sequence analysis reveals that Virachola isocrates (Fabricius, 1793) (type locality in India) forms a subclade genetically differentiated from its congeners at the subgenus level (Fig. 24 green and brown), e. g., COI barcodes differ by 5.5 % (36 bp) between V. isocrates and Virachola perse (Hewitson, 1863) (type locality in North India), and, therefore, it represents a new subgenus. This new subgenus is differentiated from its relatives by straighter and less jagged margins of the discal bands on the ventral side of the wings (not as rounded, arc-like in every cell or even separated into spots as in typical Virachola), straighter and paler, more continuous darker bands being more similar to Deudorix Hewitson, 1863 (type species Dipsas epijarbas F. Moore, 1858), a more prominent orange lunule near the ventral hindwing tornus, and the lack of blue areas on the dorsal side of the wings. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce 9657.10.14: T 7356 C, cce 30130.8.1: C 231 T, cce 30130.8.1: C 243 T, cce 5405.12.5: A 258 G, cce 4063.1.1: C 81 T, cce 678.10.1: A 132 A (not G), cce 2577.1.1: G 282 G (not A), cce 2577.1.1: T 291 T (not C), cce 4059.1.4: C 252 C (not T), cce 3672.3. 1: C 126 C (not T); and COI barcode: A 22 A, A 114 A, C 274 C, T 505 C, A 562 T, T 604 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDCFB1DABD2F858.taxon	etymology	Etymology. The name is formed from the type species name [iso] Crates and is a masculine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDCFB1DABD2F858.taxon	discussion	Species included. Only the type species (i. e., Hesperia isocrates Fabricius, 1793). Parent taxon. Genus Virachola F. Moore, 1881.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDBFE80ABDEFB88.taxon	description	http: // zoobank. org / 2500 C 4 A 7 - 39 A 3 - 4 A 9 A-A 24 A- 46058014 FE 94	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDBFE80ABDEFB88.taxon	type_taxon	Type species. Myrina epirus C. Felder, 1860.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDBFE80ABDEFB88.taxon	description	Definition. DNA sequence analysis reveals that several species of Deudorix Hewitson, 1863 (type species Dipsas epijarbas F. Moore, 1858) form a subclade genetically differentiated from others at the subgenus level (Fig. 24 blue and dark blue); e. g., their COI barcodes differ by 5.8 % (38 bp), and, therefore, they represent a new subgenus. This new subgenus is differentiated from its relatives by its creamy-white ventral wings with dark brown discal and submarginal bands and margins, a longitudinal stripe in the anal area of the hindwing, and an orange stripe with dark spots (some blue-pupilled) extending from the tornus along the submarginal band, sometimes penetrating it. In DNA, a combination of the following characters is diagnostic in the nuclear genome: cce 3391.1.3: A 1839 G, cce 49.4.1: A 150 T, cce 8439.15.1: T 595 C, cce 8439.15.1: T 945 A, cce 2318.3.4: G 270 A, cce 1567.13.2: T 48 T (not A), cce 303136.3.19: T 96 T (not C); and COI barcode: T 133 A, A 268 G, T 391 A, T 436 A, T 536 C, A 538 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDBFE80ABDEFB88.taxon	etymology	Etymology. The name is formed from [Ara] wacus Kaye, 1904, a Neotropical genus of Lycaenidae with a striped pattern in many species reminiscent of this new subgenus, but with additional stripes (thus a longer name). Furthermore, the name hints at a ventral wing pattern that is odd and eccentric (i. e., " wacky ") for Deudorix. The name is a masculine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5F7228FDDBFE80ABDEFB88.taxon	discussion	Species included. The type species (i. e., Myrina epirus C. Felder, 1860), Deudorix ceramensis Ribbe, 1901, Deudorix eos Hewitson, 1863, Deudorix maudei Joicey & Talbot, 1916, Deudorix niepelti Joicey & Talbot, 1922. Parent taxon. Genus Deudorix Hewitson, 1863.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5E7229FE35FFFEADA7FE0C.taxon	discussion	Genomic phylogeny places the allotype of Deudorix batikelides W. Holland, 1920 (type locality in Congo, NVG- 20127 G 06) (Fig. 24 labeled in orange) in the same clade with Pilodeudorix H. H. Druce, 1891 (type species Pilodeudorix barbatus H. H. Druce, 1891, which is regarded as a junior subjective synonym of Sithon camerona Plötz, 1880) (Fig. 24 cyan) and away from Deudorix Hewitson, 1863 (type species Dipsas epijarbas F. Moore, 1858) (Fig. 24 blue). While we were unable to find the holotype of D. batikelides, we use the allotype to represent this species and transfer D. batikelides from Deudorix to Pilodeudorix, forming Pilodeudorix batikelides (W. Holland, 1920), comb. nov.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5E722AFD91FD37AC95F9E1.taxon	description	http: // zoobank. org / 03 E 1 BABC-DBC 8 - 4 A 41 - 8438 - 2 F 0 AEB 2 EA 823 (Figs. 25 part, 26 – 27)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5E722AFD91FD37AC95F9E1.taxon	materials_examined	Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 26 (genitalia Fig. 27), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [ECUADOR | Pichincha Province | Hotel Tinalandia | 12 km E Santa | Domingo de los | Colorados | 750 – 850 m | 13 May 1988 | leg G & A Austin], [Phanus vitreus | (Stoll) | det GT Austin 199 1], [Genitalia Vial | GTA- 2247], [Phanus ecitonorum | Austin | det. G. T. Austin | 1992], [G T Austin colln | MGCL Acc. | 2004 - 5], [DNA sample ID: | NVG- 24074 D 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Phanus ecutinus | Grishin]. Type locality. Ecuador: Pichincha, Santo Domingo de los Colorados, Tinalandia Lodge.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5E722AFD91FD37AC95F9E1.taxon	etymology	Etymology. The name is given for the type locality and is a fusion of Ecu [ador] + Tin [alandia] + us. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5E722AFD91FD37AC95F9E1.taxon	distribution	Distribution. Currently known only from the holotype collected west of the Andes in northern Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5D722CFDBAF9F6AA22FDC1.taxon	description	http: // zoobank. org / D 6 F 4 DA 98 - 5 D 23 - 4697 - 90 C 1 - DF 47 DF 63 DC 0 A (Figs. 28 part, 29 – 30, 50 part, 51 a)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5D722CFDBAF9F6AA22FDC1.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Zoologische Staatssammlung München, Germany (ZSMC), illustrated in Figs. 29 and 51 a, bears the following three printed rectangular labels, two white: [Amazonas | Coll Fassl | in Coll. Arp], [DNA sample ID: | NVG- 22017 H 08 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | zeus Grishin]. Paratypes: 2 ♂♂: 1 ♂ NVG- 22017 H 07 with the same data as the holotype and 1 ♂ NVG- 15099 B 11 Brazil, Amazonas, Madeira River, Manicoré, Nov- 1923, Bruno Poll leg., genitalia slide No. 488 (Fig. 30) [CMNH]. Type locality. Brazil: Amazonas, likely mid-Amazon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5D722CFDBAF9F6AA22FDC1.taxon	etymology	Etymology. We arrived at the name starting from “ fuzzy ” for the blurred (compared to its relatives) border between dark-brown and orange by the dorsal hindwing tornus of this species: fuzz [y] + [Enth] eus → [fuz] zeus → zeus, and it seems suitable for this bright-orange species fitting to be the king. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5D722CFDBAF9F6AA22FDC1.taxon	distribution	Distribution. Currently known only from the type locality in the Amazonian region.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5D722CFDBAF9F6AA22FDC1.taxon	discussion	Comment. We have not attempted to remount the old genitalia slide No. 488 (currently in the CMNH cabinet with genitalia slides, mostly prepared by R. Williams) and illustrate genitalia here in their original condition, as mounted, without cleaning (Fig. 30).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B5B722DFE01FDACAA9DFB7E.taxon	discussion	Genomic analysis reveals that sequenced specimens that we identified as Entheus priassus (Linnaeus, 1758) (type locality stated as “ Indiis ”, likely in or around Suriname) partition into three species (Fig. 31, marked as yellow-highlighted 1, 2, and 3 above their clades). The first species is more widespread with specimens sequenced from Venezuela, Guyana, Suriname, and French Guiana. The second and the third species were sequenced from French Guiana (and one specimen from Brazil: Amapá) and Guyana, respectively (Fig. 32). We note that these distribution records are based only on several sequenced specimens and are necessarily incomplete, to be addressed by more comprehensive sequencing. The first species is characterized by males with wider yellow-orange bands and more developed hyalinity along the distal margin of the discal band, and females with more restricted pale spotting, including the discal spot on the dorsal hindwing and wider separation between white forewing spots in the discal cell and the cell CuA 1 - CuA 2, with the latter spot being out of alignment with (tilted distad from) the former. This phenotype matches best the lectotype illustration of Papilio peleus Linnaeus, 1763 (type locality stated as “ Indiis ”, likely in the Guianas), a male, by Clerck ([1764]) and the illustration of Entheus cramerianus Mabille, 1898 (type locality in Suriname and French Guiana) syntype from Suriname in Stoll (1782), a female. We note that in our interpretation of the original description (Mabille 1898), the type series of E. cramerianus consists of females only: the specimen identified as Papilio talaus and illustrated in fig. C, pl. 393 in Stoll (1782), referred to as “ Pap. Talaus Cram. pl. 293, nec Lin ” (293 is a lapsus for 393) by Mabille (1898) and female specimens considered to belong to this species and inspected by Mabille (1898), which he referred to as “ On le reçoit de la Guyane assez fréquemment ” (“ we receive it from [French] Guiana quite frequently ”). For the stability of nomenclature, we maintain the synonymy between P. peleus and Papilio priassus Linnaeus, 1758 (type locality stated as “ Indiis ”, likely in or around Suriname), described from male (s), not illustrated, the original description agrees with males of any of these three (and many other Entheus) species, and identify this first species as P. priassus. Neotypes for these taxa are designated below to preserve this synonymy in prevailing usage. The second species is characterized by narrower and straighter at margins orange bands with less hyalinity in males, and females with larger white spots, including the discal spot on the dorsal hindwing and better aligned, larger spots in the forewing discal cell and the cell CuA 1 - CuA 2, with these two spots and the spot in the cell CuA 2 - 1 A + 2 A forming a white band. This phenotype agrees best with the lectotype illustration of Papilio talaus Linnaeus, 1763 (type locality stated as “ Indiis ”, likely in or around Suriname), a female, by Clerck ([1764]), a syntype illustration of Peleus aeacus Swainson, 1831 (type locality in South America), a male, by Swainson (1831) and a syntype of Phareas serenus Plötz, 1883 (type locality not specified) from the Weymer collection that we located in MFNB. Therefore, we propose that Entheus talaus (Linnaeus, 1763), stat. rest. is a species distinct from Entheus priassus (Linnaeus, 1758); Papilio peleus Linnaeus, 1763 with Entheus cramerianus Mabille, 1898 are junior subjective synonyms of Entheus priassus; and Peleus aeacus Swainson, 1831 with Phareas serenus Plötz, 1883 are junior synonyms of Entheus talaus. This treatment appears most consistent with the available literature on these taxa, and lectotypes or neotypes for most of them are designated accordingly in the sections below. The third species, from Guyana, differs by the doublet of semi-hyaline spots in forewing cells M 1 - M 2 and M 2 - M 3 being stronger offset distad from the triplet of the subapical spots (in a female, this doublet is narrower compared to other species) and the semi-hyaline spot in the cell M 3 - CuA 1 only narrowly connected to the discal orange band (among other characters) and is new, described below. Genomic trees focusing on this subgroup of three species are shown in Fig. 32.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B58722FFE1CFEC3ABF2F9CC.taxon	discussion	Phareas serenus Plötz, 1883 (Weymer in litt.) was described from an unstated number of specimens from unknown localities. The description given as part of the identification key (Plötz 1883) can be translated from German as “ The hindwing is broadened from the anal angle to vein 4, above with an oval oblique white discal spot, beneath broadly black almost along the entire costal margin. The forewing above at the inner margin of the discal cell with a red longitudinal streak extending to the base, and the row of spots in cells 4 – 9 is interrupted at vein 6, beneath the base is dark gray. ” Only females agree with this description. We located and sequenced (NVG- 22091 A 04) a single syntype of P. serenus in the MFNB collection (Figs. 33 d and 51 d). The syntype is from the Weymer collection, is labeled as “ … Serenus Wmr i. l ” (for “ in litteris ”), and was seen by Plötz according to its label, thus agreeing with all the details of the original description. This is likely the only specimen on which the description of P. serenus was based. However, avoiding the assumption of the holotype, to define the taxonomic identity of the name P. serenus objectively, N. V. G. hereby designates a syntype in the MFNB collection, a female illustrated in Figs. 33 d and 51 d (genitalia Fig. 34 a – c) and bearing the following eight rectangular white labels (4 th and the last three printed, others handwritten): [341 | Weymer], [Talaus | Cr 393 c], [Talaus var | Serenus Wmr i. l | 341 best. v. Plötz.], [Coll. Weymer], [60: 2.], [DNA sample ID: | NVG- 22091 A 04 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23082 A 08 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 38 | c / o Nick V. Grishin] as the lectotype of Phareas serenus Plötz, 1883. According to the 3 rd label, the name for this species proposed by Weymer in correspondence (“ i. l ”) is serenus, and this specimen was “ identified ” (probably just inspected in this case) by Plötz (“ best [immt]. v [on]. Plötz ”). The number 341 is likely an unpublished Weymer’s collection specimen number, or maybe a specimen No. 341 inspected by Plötz in Weymer’s collection. The 5 th label “ 60: 2. ” gives the number for Entheus cramerianus Mabille, 1898 (type locality in South America) in Mabille’s catalog (1903), meaning that this specimen was identified as E. cramerianus by a curator of the MFNB collection. The first DNA sample refers to the extraction from a leg and the second is from the abdomen prior to genitalia dissection. The lectotype is missing the left antenna, and every wing but the right hindwing is chipped once at its outer margin. On the basis of genomic comparison, we deduce that the type locality of P. serenus is in the Amazonian region, possibly in Brazil: Pará. The COI barcode sequence of the lectotype, sample NVG- 22091 A 04, GenBank PV 549989, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTCTACCCCCCTCTATCTGCCAATATTGC CCATCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGCGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCCGCAGGAGGAGGGGATCCTATTCTTTATCAACACTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B587221FEEFF9AAABF2FC79.taxon	discussion	The name Papilio priassus Linnaeus, 1758 was proposed from an unstated number of specimens from “ Indiis ” and the original description can be translated from Latin as “ wings rounded, uniformly black; the forewings with two tawny bands joined by a third smaller spot ” (Linnaeus 1758). Several years after the description, this species was re-described from specimen (s) in the collection of Queen Ludovica Ulrika (Linnaeus 1764). Although this description is longer, it is unclear whether it applies to this species and whether the type series was among Ulrika’s specimens. Currently, and since Aurivillius (1882), two other taxa, Papilio talaus Linnaeus, 1763 (type locality in “ Indiis ”, described from a female) and Papilio peleus Linnaeus, 1763 (type locality in “ Indiis ”, described from a male) have been treated as junior subjective synonyms of P. priassus (Evans 1952; Mielke 2005). To learn more about the taxonomic identity of this species, we searched for its syntypes among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. In particular, N. V. G. paid special attention to possible syntypes in the NHRS collection, where Clerck’s specimens are preserved, because lectotypes of P. peleus and P. talaus are specimens illustrated by Clerck ([1764]). We failed to find syntypes, which agrees with the statement in Honey and Scoble (2001) that they were lost. Not finding syntypes, we proceeded with the neotype designation. There is an exceptional need for the neotype of P. priassus to define this taxon objectively because several cryptic species are present among its relatives and its type locality is poorly defined (“ Indiis ”). Because type specimens of many Lepidoptera names proposed in the 18 th century were from Suriname, it seems plausible that at least part of the type series of P. priassus was from Suriname (Honey and Scoble 2001). Therefore, we selected a Surinamese specimen, a male, which agrees with the original description and the current application of the name, as the neotype. Hereby, N. V. G. designates the specimen in MTD shown in Figs. 33 a and 51 b (DNA sample NVG- 18095 F 12) as the neotype of Papilio priassus Linnaeus, 1758. This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. priassus, which is necessary because undescribed species are present among its close relatives, and to define the type locality that was stated in the original description as “ Indiis ”; 75.3.2. The characters to differentiate this taxon from others are given in the original description (see the translation above), and we interpret them as: rounded and uniformly dark-brown wings, discal and subapical orange bands on the forewings, and an orange spot in between them connected to the discal band; 75.3.3. The neotype specimen is a male bearing four rectangular white labels (1 st handwritten, others printed): [Surin.], [Staatl. Museum für | Tierkunde Dresden], [Stauding. & Bang-Haas | Dresden, Ankauf 1961], [DNA sample ID: | NVG- 18095 F 12 | c / o Nick V. Grishin] and shown in Figs. 33 a and 51 b; the neotype has a tear at the costal margin near the apex on each forewing and is missing the left antenna and the terminal third of the right antenna; 75.3.4. We failed to find syntypes of P. priassus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and therefore, taking into account similarly negative reports in literature (Honey and Scoble 2001), believe that they were lost; 75.3.5. The neotype closely agrees with the original description and all other information published about P. priassus, as evidenced by observing the characters stated in the original description translated above in the neotype photographs in Figs. 33 a and 51 b; 75.3.6. The neotype is from Suriname and the original type locality given as “ Indiis ” is deemed to include this area, frequently referring — for non-insular New World specimens — to the Guianas in general and Suriname in particular, (Honey and Scoble 2001); 75.3.7. The neotype is in the Museum für Tierkunde, Dresden, Germany (MTD). As a result of the neotype designation, the type locality of P. priassus becomes Suriname. The COI barcode sequence of the neotype, sample NVG- 18095 F 12, GenBank PV 549990, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B567222FE1FFC69AC50FC67.taxon	discussion	The lectotype of Papilio talaus Linnaeus, 1763 (type locality in “ Indiis ”) has been designated by Aurivillius (1882) as the specimen illustrated on the pl. 45, fig. 1 by Clerck ([1764]), The illustration of the lectotype shows a female with larger white spots than in its relatives, including the discal spot on the dorsal hindwing and better aligned larger spots in the forewing discal cell and the cell CuA 1 - CuA 2, with these two spots and the spot in the cell CuA 2 - 1 A + 2 A forming a white band. To learn more about the taxonomic identity of this species, we searched for its lectotype among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. In particular, N. V. G. paid special attention to Entheus Hübner, [1819] specimens in the NHRS collection, where Clerck’s specimens are preserved, because the lectotype is a specimen illustrated by Clerck ([1764]). The lectotype was not found, which agrees with the statement in Honey and Scoble (2001) that they have not located Linnaean specimens of this species. Not finding the lectotype, we proceeded with the neotype designation. There is an exceptional need for the neotype of P. talaus to define this taxon objectively because several cryptic species are present among its relatives and its type locality is poorly defined (“ Indiis ”). For the neotype, we selected a female, which looks particularly similar in wing patterns to Clerck’s illustration among the specimens we examined. This specimen is the lectotype of Phareas serenus Plötz, 1883 (type locality in South America: the Amazonian region). Hereby, N. V. G. designates the lectotype of P. serenus in MFNB shown in Figs. 33 d and 51 d (DNA sample NVG- 22091 A 04) as the neotype of Papilio talaus Linnaeus, 1763. As a result of the neotype designation, Phareas serenus Plötz, 1883 becomes a junior objective synonym of Papilio talaus Linnaeus, 1763. This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. talaus, which is necessary because new species are present among its close relatives, and to define the type locality that was stated in the original description as “ Indiis ”; 75.3.2. The characters to differentiate this taxon from others are revealed from the illustrations of its lectotype in Clerck ([1764]) and are given above, i. e., larger white spots, such as the discal spot on the dorsal hindwing and better aligned spots in the forewing discal cell and the cell CuA 1 - CuA 2: these two spots and the spot in the cell CuA 2 - 1 A + 2 A form a white band, two white spots are present in the forewing cell CuA 2 - 1 A + 2 A of the lectotype, white area on the ventral hindwing reaches the inner margin and is angled rather than rounded distad of the discal cell; 75.3.3. The neotype specimen is a female bearing the following eight rectangular white labels (4 th and the last three printed, others handwritten): [341 | Weymer], [Talaus | Cr 393 c], [Talaus var | Serenus Wmr i. l | 341 best. v. Plötz.], [Coll. Weymer], [60: 2.], [DNA sample ID: | NVG- 22091 A 04 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23082 A 08 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 38 | c / o Nick V. Grishin] and shown in Figs. 33 d and 51 d; this specimen is also the lectotype of Phareas serenu s Plötz, 1883 (see the lectotype designation section above for additional details about this specimen and its labels); 75.3.4. We failed to find the lectotype and paralectotypes of P. talaus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and therefore, taking into account similarly negative reports in literature (Honey and Scoble 2001), believe that they were lost; 75.3.5. The neotype closely agrees with the illustration of the P. talaus lectotype in all characters, as evidenced by comparing the neotype shown in Figs. 33 d and 51 d with the illustration on the pl. 45, fig. 1 in Clerck ([1764]) and the characters for this taxon listed above (75.3.2.), e. g., even a semi-hyaline spot by the 1 A + 2 A vein on the forewing is present in the neotype and lectotype; 75.3.6. The neotype is from unknown locality identified as in the Amazonian region of South America (possibly in Brazil: Pará) by genomic analysis and the original type locality given as “ Indiis ” is deemed to include this area, because for non-insular specimens from the New World it typically referred to the Guianas region (Honey and Scoble 2001). The type locality will be further refined by genomic comparisons with additional specimens from across South America; 75.3.7. The neotype is in the Museum für Naturkunde, Berlin, Germany (MFNB). The COI barcode sequence of the neotype is given above in the section “ Lectotype designation for Phareas serenus Plötz, 1883. ”	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B557223FE1DFC47ABF2FCC1.taxon	discussion	The lectotype of Papilio peleus Linnaeus, 1763 (type locality in “ Indiis ”) has been designated by Aurivillius (1882) as the specimen illustrated on pl. 45, fig. 5 by Clerck ([1764]). The illustration of the lectotype shows a male with wider yellow-orange bands and more developed hyalinity along the distal margin of the discal band. To learn more about the taxonomic identity of this species, we searched for its lectotype among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. In particular, N. V. G. paid special attention to Entheus Hübner, [1819] specimens in the NHRS collection, where Clerck’s specimens are preserved, because the lectotype is a specimen illustrated by Clerck ([1764]). The lectotype was not found, which agrees with the results by Honey and Scoble (2001) who have not found type specimens of this species. Not finding the lectotype, we proceeded with the neotype designation. There is an exceptional need for the neotype of P. peleus to define this taxon objectively because several cryptic species are present among its relatives and its type locality is poorly defined (“ Indiis ”). For the neotype, we selected a male, which looks most similar in wing patterns to Clerck’s illustration among the specimens we examined. Clerck’s illustration shows an unusual character: the semi-hyaline orange-yellow spot in the forewing cell M 3 - CuA 1 reaches (and even overlaps with in some copies of the book) the subapical semi-hyaline band. Because this character seems to be present as an unusual aberration only, and is variably shown in different copies of the book by Clerck ([1764]), we hypothesize that it might have been an artifact of the drawing. Nevertheless, we selected a specimen with a comparatively smaller gap between the spot and the band. Hereby, N. V. G. designates the specimen in USNM shown in Figs. 33 b and 51 c (DNA sample NVG- 23117 A 03) as the neotype of Papilio peleus Linnaeus, 1763. This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. peleus, which is necessary because new species are present among its close relatives, and to define the type locality that was stated in the original description as “ Indiis ”; 75.3.2. The characters to differentiate this taxon from others are revealed from the illustrations of its lectotype in Clerck ([1764]) and are given above, i. e., broader forewing orange bands with more extensive hyalinity along the distal margin of the discal band; 75.3.3. The neotype specimen is a male bearing three rectangular printed white labels: [St. Jean, | Maroni, | F. Guiana], [Collection | WmSchaus], [DNA sample ID: | NVG- 23117 A 03 | c / o Nick V. Grishin] and shown in Figs. 33 b and 51 c; the neotype’s antennae overlap wings above, and the right hindwing has a thin linear scratch from the apex towards the inner margin on the ventral side; 75.3.4. We failed to find the lectotype and paralectotypes of P. peleus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and therefore, taking into account similarly negative reports in literature (Honey and Scoble 2001), believe that they were lost; 75.3.5. The neotype closely agrees with the illustration of the P. peleus lectotype in nearly all characters, as evidenced by comparing the neotype shown in Figs. 33 b and 51 c with the illustration on pl. 45, fig. 5 in Clerck ([1764]) and the characters for this taxon listed above (75.3.2.); 75.3.6. The neotype is from French Guiana and the original type locality given as “ Indiis ” is deemed to cover this area because for non-insular specimens from the New World, it typically referred to the Guianas region (Honey and Scoble 2001); 75.3.7. The neotype is in the National Museum of Natural History, Washington, DC, USA (USNM). As a result of the neotype designation, the type locality of P. peleus becomes French Guiana: Saint-Jean-du-Maroni. The COI barcode sequence of the neotype, sample NVG- 23117 A 03, GenBank PV 549991, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTGGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATCGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTGGTACCTTTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTTTACCCCCCTTTATCTGCTAATATTGC CCACCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGTGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTCTTTATCAACACTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B547223FEECFCAAAC2FFAE0.taxon	discussion	The name Peleus aeacus Swainson, 1831 (type locality at least in Suriname) was proposed from an unstated number of specimens that, in addition to the specimen shown on pl. 284, fig. F in Cramer (1780), included the specimen illustrated in Swainson (1831). It is not a replacement name, but a name that, according to Swainson, included Cramer’s concept of Papilio peleus Linnaeus, 1763. Cramer’s specimen, although it was included in the type series, does not agree with the original description, because the forewing discal band is not “ united to a spot ” between the bands, and is not conspecific with the specimen illustrated by Swainson (1831). Therefore, Swainson’s specimen better represents the author’s concept of this species. To stabilize nomenclature and define the name P. aeacus objectively, N. V. G. hereby designates a syntype illustrated on pl. 75, fig. 2 in Swainson (1831) as the lectotype of Peleus aeacus Swainson, 1831. The provenance of this specimen remains unknown, but this phenotype has been known from South America (most probably the Guianas region), which becomes the type locality of this taxon. This lectotype designation is necessary to exclude Cramer’s specimen as the name bearer.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B547224FE1BFACBABF2FC8A.taxon	discussion	The illustration of the lectotype of Peleus aeacus Swainson, 1831 (type locality in South America, likely in the Guianas) reveals that it is a species characterized by males with forewing orange bands that are narrower, straighter at the margins, and exhibit less hyalinity. To learn more about the taxonomic identity of this species, we searched for its lectotype among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. In particular, the remainder of Swainson’s collection of insects is preserved at the University of Cambridge, UK (Anonymous 2025). We searched the collection catalogue and did not find any Entheus specimens. Not finding the lectotype, we proceeded with the neotype designation. There is an exceptional need for the neotype of P. aeacus to define this taxon objectively because several cryptic species are present among its relatives, and its type locality is not specified in the original description (Swainson 1831). For the neotype, we selected a male, which, among the specimens we examined, looks most similar in wing patterns to the illustration of the lectotype on pl. 75, fig. 2 by Swainson (1831). Hereby, N. V. G. designates the specimen in SMF shown in Fig. 33 c (DNA sample NVG- 18038 E 04) as the neotype of Peleus aeacus Swainson, 1831. This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of P. aeacus, which is necessary because new species are present among its close relatives, and to define the type locality that was not stated in the original description; 75.3.2. The characters to differentiate this taxon from others are revealed from the original description and the illustration of its lectotype on pl. 75, fig. 2 in Swainson (1831) and are given above, i. e., narrower and straighter at the margins forewing orange bands with less hyalinity; 75.3.3. The neotype specimen is a male bearing two white labels (1 st handwritten on glassine paper, 2 nd printed): [Guyana Iracoubo | Rocoucoua | III. 85], [DNA sample ID: | NVG- 18038 E 04 | c / o Nick V. Grishin], and shown in Fig. 33 c; the neotype has a chipped inner margin of the right hindwing in the middle and its right antenna points more anteriad rather than along the costal margin of the forewing; 75.3.4. We failed to find the lectotype of P. aeacus among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list and see above) and catalogs we searched and believe that it was lost; 75.3.5. The neotype closely agrees with the illustration of the P. aeacus lectotype in all characters, as evidenced by comparing the neotype shown in Fig. 33 c with the illustration on pl. 75, fig. 2 in Swainson (1831) and the characters for this taxon listed above (75.3.2.); 75.3.6. The neotype is from French Guiana and the original type locality “ South America ” agrees with it, as this phenotype is found mostly in the Amazonian region; 75.3.7. The neotype is in the Senckenberg Naturmuseum, Frankfurt, Germany (SMF). As a result of the neotype designation, the type locality of P. aeacus becomes French Guiana: Iracoubo, Rococoua. The COI barcode sequence of the neotype, sample NVG- 18038 E 04, GenBank PV 549992, 658 base pairs, is: AACTTTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTGGGAGCCCCTGACATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGACTCTTACCCCCATCATTAACATTATTAATTTCTAGAAGAATTGTTGAAAATGGAGCTGGAACAGGATGAACTGTCTACCCCCCTCTATCTGCCAATATTGC CCATCAAGGATCTTCTGTAGATTTAGCCATTTTTTCCCTTCATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCA TTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGTATTACTGCATTACTTTTATTATTATCTTTACCCGTATTAGCAGGCGCTATTACTATACTTTTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCCGCAGGAGGGGGGGATCCTATTCTTTATCAACACTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B537225FE63FC1DAC0EF96B.taxon	description	http: // zoobank. org / 630 FF 944 - AA 31 - 4407 - A 16 A- 9193 FCA 95218 (Figs. 31 – 32 part, 35, 36 a – d, 50 part, 51 e – f)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B537225FE63FC1DAC0EF96B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Figs. 35 a and 51 e (genitalia Fig. 36 a – d), bears the following six printed rectangular labels, five white: [GUYANA: Cuyuni R, | Kamaria Falls 100 ' | 30. XI. - 5. XII. 2000 | 6 ° 24 ' N 58 ° 546 ' W | Leg. S. Fratello et al], [DNA sample ID: | NVG- 14062 D 01 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 D 12 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 39 | c / o Nick V. Grishin], [{QR Code} | USNM ENT 00179768], and one red [HOLOTYPE ♂ | Entheus | guyaneus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 1 ♂ and 2 ♀♀ with the same data as the holotype except as indicated: 1 ♂ NVG- 14062 C 05 USNM ENT 00179818, 1 ♀ NVG- 14062 D 05 USNM ENT 00275189, and 1 ♀ NVG- 23112 G 08 Kartabo, 10 - Jul- 1925, G. D. Morgan leg. [CMNH]. Type locality. Guyana: Cuyuni-Mazaruni Region, Cuyuni River, Kamaria Falls, approx. GPS 6.40, − 58.77.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B537225FE63FC1DAC0EF96B.taxon	etymology	Etymology. The name is formed from the name of the country with the type locality and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B537225FE63FC1DAC0EF96B.taxon	distribution	Distribution. Currently known only from north-central Guyana (Cuyuni-Mazaruni Region).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B527238FE6BF97FABEDFD3E.taxon	description	http: // zoobank. org / CE 830 AFA- 9 AE 0 - 4 B 04 - A 57 B- 7 C 81 ECDAECBE (Figs. 31 part, 37 – 38, 50 part, 51 h)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B527238FE6BF97FABEDFD3E.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Figs. 37 and 51 h (genitalia Fig. 38), bears the following six printed (text in italics handwritten) rectangular labels, five white: [East Colombia], [734], [Genitalia Slide | No. 483], [Exch. A. N. S. P. | C. M. Acc. 20359], [DNA sample ID: | NVG- 15099 C 09 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | colombeus Grishin]. Type locality. Eastern Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B527238FE6BF97FABEDFD3E.taxon	etymology	Etymology. The name is formed from the type locality and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B527238FE6BF97FABEDFD3E.taxon	distribution	Distribution. Currently known only from the holotype collected in eastern Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B527238FE6BF97FABEDFD3E.taxon	discussion	Comment. We have not attempted to remount the old genitalia slide No. 438 (currently in the CMNH cabinet with genitalia slides, mostly prepared by R. Williams) and illustrate genitalia here in their original condition, as mounted with dorsal tips of both harpes folded over, likely during the slide preparation (Fig. 38). The harpes are three-dimensional and smoothly curve inward (towards each other), creating a challenge with mounting on a flattened slide.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4F7239FE61FCBAAC75FCE1.taxon	description	http: // zoobank. org / 4 EE 1 D 5 A 2 - 1 A 38 - 4181 - 92 C 5 - 41 E 59 B 1 C 5 AB 2 (Figs. 31 part, 36 e – g, 39, 50 part, 51 i)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4F7239FE61FCBAAC75FCE1.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Figs. 39 and 51 i (genitalia Fig. 36 e – g), bears the following seven printed rectangular labels, six white: [Belém, Pará | Brazil | January 11, 1961 | D. L. Lindsley], [Entheus Hübner | priassus (Linnaeus) | telemus Mabille], [D. L. Lindsley colln. | MGCL Accession | # 2008 - 20], [DNA sample ID: | NVG- 23064 B 05 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24064 A 01 | c / o Nick V. Grishin], [genitalia: | NVG 241111 - 01 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | proxemus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Brazil: Pará, Belém.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4F7239FE61FCBAAC75FCE1.taxon	etymology	Etymology. The name is constructed as an antonym of its sister species’ name, telemus. In Greek, τηλε- (tele -) is a prefix that means distant or far away. In Latin, proximus means nearest or next, and the name formed from this word is given to this species, nearest to E. telemus, with the distribution next to it. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4F7239FE61FCBAAC75FCE1.taxon	distribution	Distribution. Currently known only from the holotype collected in the lower Amazonian region.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4E723AFE66FCF5AA7AF9F9.taxon	description	http: // zoobank. org / 8 C 6657 DF- 7 D 8 B- 4 BF 8 - B 177 - F 17 E 64 A 7 C 11 F (Figs. 31 part, 36 h – k, 40, 50 part, 51 j – k)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4E723AFE66FCF5AA7AF9F9.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Figs. 40 a and 51 k (genitalia Fig. 36 h – k), bears the following five printed (text in italics handwritten) rectangular labels, four white: [PERU Madre De Dios | Rio La Torre 300 m | Tambopata Res. | 31 OCT. ’ 84 | S. S. Nicolay], [DNA sample ID: | NVG- 14062 B 08 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 01 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 40 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | peruveus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 3 ♂♂ and 1 ♀ from Peru, Madre de Dios: 1 ♂ NVG- 23116 H 05 data as the holotype but 6 - Oct- 1986, D. H. Ahrenholz leg.; 1 ♂ NVG- 23064 B 06 near the type locality, given as Rio Tambopata, 60 km S Puerto Maldonado, Rio Tambopata, 60 km S Puerto Maldonado, D. & J. Lindsley leg. [MGCL]; 1 ♂ NVG- 23116 H 04 30 km SW Pto. Maldonado, 300 m, 20 - Oct- 1983, S. S. Nicolay leg. [USNM]; and 1 ♀ NVG- 14062 B 03 Manu National Park, Pakitza, − 12.1167, − 70.9667, 16 - Sep- 1989, D. J. Harvey leg. [USNM] (Figs. 40 b, 51 j). Type locality. Peru: Madre de Dios Region, Tambopata National Reserve, Rio La Torre, elevation 300 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4E723AFE66FCF5AA7AF9F9.taxon	etymology	Etymology. The name is formed from the name of the country with the type locality and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4E723AFE66FCF5AA7AF9F9.taxon	distribution	Distribution. Currently known from southeastern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4D723CFE65F9EEA9F7FE7B.taxon	description	http: // zoobank. org / 88821 A 37 - 2 D 04 - 4 B 28 - 9571 - 10216 DE 05 D 49 (Figs. 31 part, 34 d – f, 41, 50 part, 51 l)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4D723CFE65F9EEA9F7FE7B.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Figs. 41 and 51 l (genitalia Fig. 34 d – f), bears the following six rectangular labels (first two handwritten, others printed), five white: [Massauary | Hahn.], [abgebildet], [DNA sample ID: | NVG- 22091 B 03 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24029 A 08 | c / o Nick V. Grishin], [genitalia: | NVG 241114 - 19 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Entheus | hyponota Grishin]. It was collected by Paul Hahnel and illustrated in Staudinger (1884 – 1888). The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Brazil: Amazonas, Massauari.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4D723CFE65F9EEA9F7FE7B.taxon	etymology	Etymology. The name is given to rhyme with its sister species E. aureanota, replacing aureo - with hypo - (in Greek, meaning under- or below, and - nota meaning mark or spot in Latin) for the underdeveloped white region on the dorsal hindwing compared to its sister. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4D723CFE65F9EEA9F7FE7B.taxon	distribution	Distribution. Currently known only from the holotype collected in the middle Amazonian region in Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4B723CFE2DFE49AC0DFCDE.taxon	discussion	Genomic analysis reveals that Entheus priassus pralina Evans, 1952 (type locality in Brazil: Espirito Santo) is not sister to and genetically differentiated from Entheus priassus (Linnaeus, 1758) (type locality in Suriname) at the species level (Figs. 31, 50); e. g., their COI barcodes differ by 1.4 % (9 bp). This is a comparatively large COI difference for Entheus, e. g., COI barcodes of E. priassus and Entheus curvus Austin, 1997 (type locality in Peru: Loreto) differ by 0.6 % (4 bp). Therefore, we propose that Entheus pralina Evans, 1952, stat. nov. is a species distinct from Entheus priassus (Linnaeus, 1758).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4B723DFDBFFCDDADF0FCA9.taxon	description	http: // zoobank. org / CB 2 B 2 C 09 - 31 DE- 4656 - A 791 - D 3 DFFDCA 9 A 46 (Figs. 31 part, 34 g – i, 42, 50 part, 51 g)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4B723DFDBFFCDDADF0FCA9.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Figs. 42 and 51 g (genitalia Fig. 34 g – i), bears the following seven rectangular labels (2 nd and 3 rd handwritten, others printed, 2 nd bluish green, last red, and others white): [5146], [Talaus | Lin. Cl. Ic. 45. f. 1. | Cram. 393. C. Fab. | Hüb. Lep. ex. Vol. II. | | Bah. Sello – Pará Sieb], [talaus | L. | (priassus | L. | phereclus | L. | peleus Cl.)], [DNA sample ID: | NVG- 15032 C 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24028 H 12 | c / o Nick V. Grishin], [genitalia: | NVG 241114 - 18 | c / o Nick V. Grishin], and [HOLOTYPE ♀ | Entheus | lina Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. The holotype is one of four specimens in the lot number 5146, per the historical collection catalog, and was collected in Brazil either in Bahia by Friedrich Sello [w] or Pará by Friedrich Wilhelm Sieber. Considering substantial genetic differentiation between this new species and E. pralina from southern Brazil, we hypothesize that the holotype was collected in Pará. Type locality. Brazil: Pará.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4B723DFDBFFCDDADF0FCA9.taxon	etymology	Etymology. The name is the last two syllables of the name of its sister species, shortened to indicate the more northern distribution of this species. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4B723DFDBFFCDDADF0FCA9.taxon	distribution	Distribution. Currently known only from the holotype collected in Brazil, likely Pará.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B4A723FFEBEFC24ACA4FDAC.taxon	discussion	Entheus matho Godman & Salvin, 1879 was described on the basis of several specimens from Guatemala: Choctum (a small settlement Choctun in Alta Verapaz Department approx. GPS 15.67, − 90.42 according to Selander and Vaurie (1962), one specimen from this locality, as deduced from the text in Godman and Salvin (1894 )) and Nicaragua: Chontales (several specimens) (Godman and Salvin 1879). A specimen from Guatemala: Alta Verapaz, Senahú (approx. GPS 15.43, − 89.90 according to Selander and Vaurie (1962 )) was illustrated by Godman and Salvin (1894) after the original description of E. matho, but it is not a syntype, because it is not from the type locality. Notably, both localities in Guatemala (Senahú and Choctum) are mentioned in Godman and Salvin (1894), but only one (Choctum) bears a superscript ‘ 1 ’ after the authors’ names, referencing the original description (as the locality in Nicaragua after the collector’s name). This mention of the two Guatemalan localities and a particular way of referencing by the superscript (Senahú is not referring to the original description) supports the conclusion that the specimen from Senahú is not a syntype. Notably, this specimen is not conspecific with most other specimens in the type series, which has led to confusion in the literature. For instance, Steinhauser (1989) misidentified “ matho ” and attributed this name to a species represented by this non-syntypic male from Senahú and illustrated in Godman & Salvin (1894: pl. 81, fig. 28). In addition to the spread specimen, Godman & Salvin (1894: pl. 81, fig. 29) also illustrated the genitalia (reproduced here as Fig. 43 c) of a syntype (Fig. 43 a, b), and male genitalia can be used to identify E. matho, differing from other species by a wider harpe with a strongly convex ventral margin. To stabilize nomenclature and define the name E. matho objectively in the light of confusion with the published misidentified illustration of its spread male that is not a syntype, N. V. G. hereby designates a syntype in the BMNH collection, a male with genitalia illustrated by Godman and Salvin (1894), that bears the following four rectangular printed labels and a genitalia minislide No. 108 pinned together with labels: [Chontales, | Nicaragua. | T. Belt.], [B. C. A. Lep. Rhop. | Entheus | matho, | G. & S.], [Godman-Salvin | Coll. 1912. — 23.], [BMNH (E) # 1054270] as the lectotype of Entheus matho Godman & Salvin, 1879. The lectotype has scales completely removed from its left wings to reveal venation and has the right forewing tornus chipped away. Images of this specimen are shown on the Butterflies of America website (Warren et al. 2024). The type locality of E. matho becomes Nicaragua: Chontales. As a result, the species that Steinhauser (1989) misidentified as “ matho ” does not have a name and is new, described below.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B487230FD81FD37ADFAFBCE.taxon	description	http: // zoobank. org / 27 E 9 B 5 AA- 849 F- 4216 - 9962 - 841 BA 9008949 (Figs. 43 d, 44 part, 45, 50 part, 51 m)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B487230FD81FD37ADFAFBCE.taxon	materials_examined	Type material. Holotype: ♂ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Figs. 45 and 51 m, bears the following six printed (text in italics handwritten) rectangular labels, five white: [MEX., Chiapas, | 27 km. S. E. Sta. Rosa | June ’ 69; P. Hubbell], [Collection of | C. D. MacNeill], [Entheus matho | matho G. & S. | Det. C. D. MacNeill ' 87], [] both antennae and a leg are glued to this label, no text, [DNA sample ID: | NVG- 15105 A 05 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | guato Grishin]. Paratypes: 5 ♂♂ and 1 ♀: Mexico, Chiapas: 1 ♂ NVG- 14101 C 03 no detailed locality, coll. Franck Johnson, genitalia slide G 2176 [AMNH] and Comitán, Santa Rosa, T. Escalante leg. [MGCL]: 1 ♂ NVG- 23064 A 12, Specimen no. 29216, Apr- 1959, 1 ♂ NVG- 23064 A 11, Specimen no. 29217, Feb- 1960, 1 ♂ NVG- 15026 F 08, Specimen no. 29215, Apr- 1968, and 1 ♀ NVG- 15026 F 09, Specimen no. 29220, Apr- 1968, genitalia SRS- 1211; and 1 ♂ BMNH (E) # 1054213 Guatemala, Alta Verapaz Department, Senahú, Champion leg. [BMNH]. Type locality. Mexico: Chiapas, Comitán, 27 km southeast of Santa Rosa.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B487230FD81FD37ADFAFBCE.taxon	etymology	Etymology. The name is given for the locality of the specimen misidentified and illustrated by Godman and Salvin (1894) as E. matho. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B487230FD81FD37ADFAFBCE.taxon	distribution	Distribution. Mexico: Chiapas (near the border with Guatemala) and Guatemala.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B487230FD81FD37ADFAFBCE.taxon	discussion	Comment. The specimen with better DNA preservation was selected as the holotype.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B477230FF73FBDCA8D9F976.taxon	discussion	Genomic analysis of the Entheus matho group reveals that Entheus dius Mabille, 1898 (type locality in Brazil), Entheus aequatorius Mabille & Boullet, 1919 (type locality given in the original description as “ Bolivia ” likely by mistake, and may be in Ecuador: Bolivar), Entheus latifascius M. Hering, 1925 (type locality Colombia, Chocó, Rio Micay), and Entheus matho marmato Salazar & Vargas, [2017] (type locality in Colombia: Caldas, Marmato-vereda Echandía) are not monophyletic and are genetically differentiated from Entheus matho Godman & Salvin, 1879 (type locality in Nicaragua: Chontales) and among each other at the species level (Figs. 44, 50): e. g., COI barcodes in the pairs of closest taxa differ by 1.5 % (10 bp, E. aequatorius and E. matho), 1.7 % (11 bp, E. matho marmato and E. matho), 2.3 % (15 bp, E. aequatorius and E. matho marmato), but more distant from each other, E. latifascius and E. dius differ by 5.3 % (35 bp). Therefore, instead of being subspecies of E. matho as currently considered, these four are species-level taxa: Entheus dius Mabille, 1898, stat. rest., Entheus aequatorius Mabille & Boullet, 1919, stat. rest., Entheus latifascius M. Hering, 1925, stat. rest., and Entheus marmato Salazar & Vargas, [2017], stat. nov.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B477232FD87F979AD90FF11.taxon	description	http: // zoobank. org / 3 A 566915 - 7 C 92 - 470 F- 816 F- 5063 C 76 BC 6 A 0 (Figs. 36 l – o, 44 part, 46, 50 part, 51 n)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B477232FD87F979AD90FF11.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Figs. 46 and 51 n (genitalia Fig. 36 l – o), bears the following five printed rectangular labels, four white: [PANAMA: Darien | Cana 1200 m | 13. IX. 1982 | Leg. G. B. Small], [DNA sample ID: | NVG- 14062 B 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 02 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 41 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | pano Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Panama: Darién Province, Cana, elevation 1200 m. Etymology. The name is formed from the name of the country with the type locality to end in - o as E. mato. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B477232FD87F979AD90FF11.taxon	distribution	Distribution. Currently known only from the holotype collected in eastern Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B457233FE72FE86A8E7FC7F.taxon	description	http: // zoobank. org / 3 DE 8615 E- 5 BAB- 43 AB- 8 EDD-DEA 0 B 421 FCF 3 (Figs. 36 p – z, 44 part, 47, 50 part, 51 o – p)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B457233FE72FE86A8E7FC7F.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Figs. 47 a and 51 o (genitalia Fig. 36 p – w), bears the following five printed (text in italics handwritten) rectangular labels, four white: [Rancho Grande. 1200 m. | Parque Nac. Henri Pittier | Edo. Aragua, Venezuela | T. E. Pliske VI- 29 - 75], [Genit. Prep. | SRS- 1278], [Allyn Museum | Acc. 19 80 - 29], [DNA sample ID: | NVG- 15026 F 10 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | venezuelius Grishin]. Paratypes: 2 ♂♂ and 2 ♀♀ from Venezuela, Argua: 1 ♀ NVG- 15026 F 11 the same data as the holotype, genitalia SRS- 1279 (Figs. 47 b, 51 p) and 1 ♀ NVG- 14062 C 01 Eancho Grande, 1100 m, 19 - Jun- 1985, S. S. Nicolay leg. [USNM]; 1 ♂ NVG- 14113 A 05 Yuracay, Hacienda Tropicale ca. 10 km S of San Felipe, 100 – 400 m, GPS 10.2917, − 68.6667, 26 - Jan- 23 - Feb- 1993, Kareofelas & Witham leg. [LACM]; and 1 ♂ NVG- 15032 C 11 (leg DNA extraction, sequenced), NVG- 24028 H 11 (abdomen DNA extraction and dissection) Carabobo, Puerto Cabello, no date [around 1900], Hahnel leg., genitalia vial NVG 241114 - 17 (Fig. 36 x – z) [MFNB]. Type locality. Venezuela: Aragua, Henri Pittier National Park, Rancho Grande, elevation 1200 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B457233FE72FE86A8E7FC7F.taxon	etymology	Etymology. The name is given for the country with the type locality and to rhyme with its related species, E. aequatorius. The name is treated as an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B457233FE72FE86A8E7FC7F.taxon	distribution	Distribution. Venezuela.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B447234FD99FC63A872FC73.taxon	description	http: // zoobank. org / 297 F 3822 - 5303 - 4 CE 1 - 8706 - 08138124207 A (Figs. 34 j – k, 44 part, 48, 50 part, 51 q)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B447234FD99FC63A872FC73.taxon	materials_examined	Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Figs. 48 and 51 q (genitalia Fig. 34 j – k), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ECUADOR Napo | Archidona 800 m | 10 Nov. ' 88 | S. S. Nicolay], [DNA sample ID: | NVG- 14062 C 11 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 03 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 42 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Entheus | ecuadius Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Ecuador: Napo Province, Archidona, elevation 800 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B447234FD99FC63A872FC73.taxon	etymology	Etymology. The name is formed from the name of its sister species by adding ecua - for the county with the type locality. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B447234FD99FC63A872FC73.taxon	distribution	Distribution. Currently known only from the holotype collected in the eastern slopes of the Andes of central Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B437235FD99FC75ADF7FC53.taxon	description	http: // zoobank. org / CA 6 E 6079 - 3 FF 2 - 4347 - 85 D 2 - AC 646 FD 0 EB 9 F (Figs. 44 part, 49, 50 part, 51 r)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B437235FD99FC75ADF7FC53.taxon	materials_examined	Type material. Holotype: ♂ deposited in the collection of the Academy of Natural Sciences of Drexel University, Philadelphia, PA, USA (ANSP), illustrated in Figs. 49 and 51 r, bears the following four printed (text in italics handwritten) rectangular labels, three white: [BOGOTA | COLOMBIA], [U. S. N. M. | DIUS MAB. |?], [DNA sample ID: | NVG- 22042 E 08 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Entheus | bogoteus Grishin]. Type locality. Colombia: Bogotá.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B437235FD99FC75ADF7FC53.taxon	etymology	Etymology. The name is formed from the type locality and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B437235FD99FC75ADF7FC53.taxon	distribution	Distribution. Currently known only from the holotype collected in Bogotá, Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B427248FEAEFC59ADCEFCDE.taxon	discussion	Here, we integrate our new results into the previous taxonomic arrangement of Entheus Hübner, [1819] (Evans 1952; Steinhauser 1989; Austin 1997; Austin et al. 1997; Mielke 2005; Grishin 2013) to compile a preliminary taxonomic list for the genus and suggest a phylogenetic order of the species. The phylogeny of Entheus (Fig. 50) generally agrees with phenotypic considerations and division into species groups. The eumelus, gentius, priassus, and matho groups agree with the Evans’s (1952) identification key. However, we find that E. warreni and E. bogoteus sp. n., both of which would be identifiable as members of the matho group by the presence of a separate orange spot between the forewing orange bands in males, are not monophyletic with E. matho and form a clade sister to the priassus group. Therefore, we define a separate species group for them. Furthermore, in agreement with discussions by Austin (1997) and Austin et al. (1997) based on phenotypic differences and similarities, we partition the priassus group into three subgroups, distinguishing the telemus and pralina subgroups, which are closely related to each other and fully separate only in the nuclear genome tree (Fig. 50 a). We attempt to order species to maximize the phenotypic similarity and geographic proximity of the list neighbors but without disrupting phylogenetic orders given in genomic trees (Fig. 50): i. e., a strongly supported clade in the trees is a continuous segment in the list. The evolution and diversification of Entheus are riddled with complexities due to the incongruence of the genomic trees (Fig. 50). Most notably, Entheus latifascius M. Hering, 1925, stat. rest. (type locality in Colombia: Rio Micay) is confidently placed deep within the matho group in the nuclear genome tree inferred from autosomes (Fig. 50 a), but is sister to the priassus group in both the Z chromosome and the mitochondrial genome trees (Fig. 50 b, c). Until such discrepancies are explained, we side with phenotypic similarity in choosing between the conflicting phylogenetic hypotheses in different phylogenetic trees. Here, we chose to order species groups to maintain the traditional order of Evans (1952), which agrees with phylogenetic trees. Within each group, species are arranged to maximize wing pattern resemblance (within phylogenetic constraints) between neighboring species from different groups, i. e., the brightest member of the priassus group (e. g., E. telemus) is placed after the gentius group species consisting of brightly colored species, and E. dius with the dark anal fold similar to the priassus group is near the beginning of the matho group. This arrangement results in the placement of E. crux and E. guato sp. n., large species with dark females without a white area on the hindwing, last. Further refinements of the list order are encouraged. In the resulting arrangement below, we also include two species discovered by Burns and coauthors (Janzen et al. 2011) but still unnamed, shown in gray font. Based on COI barcode comparison, we hypothesize that the third species, Entheus Burns 03, may be conspecific with E. matho. Type localities (general area only: state, region, department, or county) are in gray font. New taxa described in this study and the category of taxonomic change are in red font. Taxonomic treatment before this work (for valid names) or the category of synonym (for synonyms) and comments (phenotypic characters for species groups and subgroups refer to males) are shown in smaller font following a vertical bar | after the type locality; an equal sign = precedes synonyms given in their original genus combination; and a double dagger ‡ marks permanently invalid synonyms (e. g., objective synonyms) and unavailable names. The list covers 36 valid taxa, all at the species level, with 12 newly proposed here (and 2 yet undescribed) and 6 elevated (from subspecies or synonyms) to the species status: i. e., 16 previously listed as species with 5 additional subspecies and 1 synonym: 22 known and 14 undescribed before this work. Our study follows the trend to reveal approximately as many new Hesperiidae taxa as previously described ones in nearly every genus under revision (Austin and Mielke 1998; Austin and Mielke 2008; Medeiros et al. 2019; Siewert et al. 2020). Because our work on Entheus has not been completed yet, the list below is preliminary, given as a guide to the published knowledge, and with additions to follow.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF8C7ADB7F8AA.taxon	distribution	Brazil: Rondônia	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFA50ADA0FA25.taxon	distribution	Brazil: Rondônia	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFA0BAD57FA7E.taxon	distribution	Brazil: Rondônia	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF925AA0EF908.taxon	distribution	E Colombia	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFC07ADB8FC11.taxon	distribution	Suriname	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFC4BAD58FC3E.taxon	distribution	Brazil: Rondônia	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFA86AC36FA51.taxon	distribution	Suriname	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFA7DABDFF9C0.taxon	distribution	Colombia	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF8ECAA74F851.taxon	distribution	Brazil: Amazonas	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF941AAA4F934.taxon	distribution	Ecuador: Limoncocha	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFBCFAC09FB27.taxon	distribution	not given [Brazil: Minas Gerais from later work (Butler 1872)]	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF809ABE3F87C.taxon	distribution	Brazil: Pará	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFB90AA03FBE5.taxon	distribution	Bolivia: La Paz	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF96EAA54F8D3.taxon	distribution	Peru: Madre de Dios	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF91FAA3DF962.taxon	distribution	Brazil: Pará	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FF9F3AA7BF946.taxon	distribution	Brazil [Amazonas]	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3F7248FF2FFB7AAAA9FACF.taxon	distribution	Brazil: Amazonian region	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E724AFEA9FB5DAC54FF22.taxon	description	The original description illustrated the holotype of Cecropterus (Thorybes) oaxacensis Grishin, 2023 (type locality Mexico: Oaxaca, Tlalixtac de Cabrera, Hwy 175, ca. 5 mi north of Oaxaca City) when it was pinned through its side, unspread (Zhang et al. 2023 b). Here, we use this opportunity and publish photographs of the holotype after it has been dissected and spread, to facilitate recognition of this specimen (Fig. 52). The holotype is in the University of Texas Insect Collection, Austin, TX, USA.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFC83ACBFFCF7.taxon	distribution	“ Bolivia ” [Ecuador] | was a ssp. of matho	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFDB9AA74FD8C.taxon	distribution	Colombia: Bogota	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFBA9AA65FB9C.taxon	distribution	Mexico: Veracruz	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFF28ABCEFF1D.taxon	distribution	Peru: Loreto	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFD59AC62FD2C.taxon	distribution	Brazil [Amazonian region] | was a subspecies of matho	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFD66AA19FCCB.taxon	distribution	Ecuador: Napo	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFB8CAA08FBF1.taxon	distribution	Mexico: Chiapas	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFEDDABCAFEA0.taxon	distribution	Guyana	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFD10AC10FD07.taxon	distribution	Colombia: Chocó, Rio Micay | was a subspecies of matho	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFCF5AC8DFCB9.taxon	distribution	Colombia: Caldas |	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFCF5AC8DFCB9.taxon	discussion	was a subspecies of matho	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFC5BAC37FC2F.taxon	distribution	Nicaragua likely conspecific with Entheus Burns 03	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFC11AA27FC64.taxon	distribution	Panama: Darién	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFFFCAC06FF41.taxon	distribution	Brazil: Espirito Santo |	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFFFCAC06FF41.taxon	discussion	was a subspecies of priassus	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFF75ADB2FE85.taxon	distribution	Suriname	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFEFAAC2BFE0B.taxon	discussion	| was a synonym of priassus	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFCAFAAA6FC92.taxon	distribution	Venezuela: Aragua	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3E7249FF2FFD9CAA41FDE1.taxon	distribution	Ecuador: Esmeraldas	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3D724AFEBAFEB9ABF2FCA3.taxon	description	Genomic analysis of Eudamus coxeyi Williams, 1931 (type locality Ecuador: Huigra, holotype sequenced as NVG- 15096 B 02), currently treated as a subspecies of Cecropterus (Thorybes) egregius Butler, 1870 (type locality not specified), reveals that the two taxa are genetically differentiated at the species level (Fig. 53); e. g., their Fst / Gmin / COI barcode difference are 0.37 / 0.014 / 1.2 % (8 bp). The former taxon differs from the latter by being paler: e. g., forewing semi-hyaline spots are larger, the ventral hindwing ground color is pale brown, and hindwing fringes are white (Evans 1952). Therefore, we propose that Cecropterus (Thorybes) coxeyi (Williams, 1931), stat. rest. is a species distinct from Cecropterus (Thorybes) egregius (Butler, 1870). As a result, C. egregius becomes monotypic. The COI barcode sequence of the holotype of C. coxeyi, sample NVG- 15096 B 02, GenBank PV 550004, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGATTTGGAAATTGATTAGTTCCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCTTCATTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCAGGTACTGGTTGAACTGTTTACCCCCCTTTATCTTCTAATATTGC TCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATCACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTCTACTTTTATTACTTTCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGGGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3C724BFE8BFFFEABF2FDBD.taxon	description	Genomic analysis of Eudamus chlorothrix Röber, 1925 (type locality Peru: Pasco, Huancabamba, holotype sequenced as NVG- 18094 D 06), currently treated as a junior subjective synonym of Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality given as “ Cayenne ” [French Guiana?], syntype sequenced as NVG- 15029 F 10), reveals that the two taxa are genetically differentiated at the species level (Fig. 53); e. g., their Fst / Gmin / COI barcode difference are 0.18 / 0.012 / 2.3 % (15 bp). Therefore, we propose that Cecropterus (Thorybes) chlorothrix (Röber, 1925), stat. rest. is a species distinct from Cecropterus (Thorybes) virescens (Mabille, 1877). The COI barcode sequence of the holotype of C. chlorothrix, sample NVG- 18094 D 06, GenBank PV 550005, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCTCTTATATTAGGAGCTCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCCTCTTTAACTCTTTTAATTTCAAGAAGTATTGTTGAAAATGGTGCGGGTACTGGTTGAACTGTTTATCCCCCTTTATCTTCTAATATTGC CCATCAAGGAGCATCAGTAGATTTAGCAATTTTTTCATTACATCTTGCAGGAATTTCATCTATTCTTGGAGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTTGGAATTACAGCTTTATTATTATTACTTTCACTACCTGTTTTAGCTGGGGCCATTACTATACTATTAACTGATCGAAACTTAAATACTT CATTTTTTGATCCTGCAGGTGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3C724CFECCFD27AAE3F86B.taxon	description	http: // zoobank. org / F 47 CF 66 E- 9 C 31 - 4 CBB- 8789 - B 5 F 42 D 7 DEC 04 (Figs. 53 part, 54, 55 a – b)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3C724CFECCFD27AAE3F86B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 54, bears the following three printed (text in italics handwritten) rectangular labels, two white: [BRAZIL: Sta Catarina | Joinville, 0 – 200 m | 26 O 19 ' S 48 O 53 ' W | 28. X. 1989 | leg. H. Miers], [DNA sample ID: | NVG- 14111 A 02 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Cecropterus (Thorybes) | notochlorothrix Grishin]. Paratypes: 4 ♂♂ from Brazil: 1 ♂ NVG- 14111 A 03 Minas Gerais, Viçosa, 650 m, approx. GPS − 20.750, − 42.867, 9. II. 1990, H. Miers leg. [USNM] and São Paulo, São Paulo, D. L. Lindsley leg. [MGCL]: 1 ♂ NVG- 24124 A 07 13 - Aug- 1960, genitalia NVG 250517 - 04 (Fig. 55 a – b) and 2 ♂♂ 26 - Feb- 1961: NVG- 24124 A 08 and NVG- 24124 A 09. Type locality. Brazil: Santa Catarina, Joinville, elevation 0 – 200 m, approx. GPS − 26.3167, − 48.8833.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3C724CFECCFD27AAE3F86B.taxon	etymology	Etymology. In Greek, νότιος (notios) means southern. This modified prefix is added to the name of a relative of the new species, C. chlorothrix, which itself is a composite of two Greek words: χλωρός (chloros) for green and θρίξ (trix) for hair, literally meaning green-haired. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3C724CFECCFD27AAE3F86B.taxon	distribution	Distribution. Currently known from Southeast and South Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B3A724DFF7CFFEDAC2AFDB5.taxon	discussion	Cecropterus (Thorybes) viridissimus Grishin, 2023 (type locality in Ecuador) is an unusual species that is very similar in facies to Cecropterus (Thorybes) virescens (Mabille, 1877) (type locality given as “ Cayenne ” [French Guiana?]) and closely related to it in the protein-coding genes from autosomes (Fig. 53 a), but is sister to both C. virescens and Cecropterus (Thorybes) egregius (A. Butler, 1870) (type locality unknown) in the Z chromosome and mitochondrial genome trees (Fig. 53 b, c). Known only from its holotype, C. viridissimus might have been a hybrid or had contaminated DNA, thus explaining the phylogenetic incongruence. During further genomic sequencing, we stumbled upon two additional specimens of C. viridissimus (Figs. 53, 56), both from eastern Ecuador but from different localities distant from the type locality in the Andes of southern Ecuador. One of them is the first confirmed female of C. viridissimus (Fig. 56 b). These specimens closely cluster with the holotype and display the same incongruence of the genomic trees, thus confirming C. viridissimus as a species (Fig. 53).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B39724FFF67FF12AB44FC97.taxon	discussion	To put our surprising hypothesis that Aethilla toxeus Plötz, 1882 (type locality in Mexico) is a junior subjective synonym of Cecropterus (Murgaria) albociliatus albociliatus (Mabille, 1877) (type locality in Colombia, Panama, and Guatemala) (Zhang et al. 2023 d) to further test and to determine the phylogenetic position of the lectotype more precisely, we sampled and sequenced another leg of the A. toxeus lectotype in MFNB along with additional specimens of C. albociliatus. Genomic phylogenetic trees place the new sample of A. toxeus (NVG- 24028 H 08) together with the previously sequenced (NVG- 15032 A 10) (Fig. 57 magenta), thus confirming the synonymy. The COI barcode sequence of the lectotype, sample NVG- 15032 A 10, GenBank PV 550007, 658 base pairs, is: AACCTTATATTTTATTTTTGGAATTTGAGCAGGATTAGTAGGAACTTCTTTAAGTTTACTTATTCGAACTGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCCCTTATATTAGGAGCCCCTGACATAGCTTTCCCTCGTA TAAATAATATAAGATTTTGATTATTACCCCCATCTTTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGTACTGGATGAACAGTTTATCCCCCTTTATCCTCTAATATTGC CCACCAAGGAGCATCAGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGAATTTCTTCTATTCTTGGAGCTATTAACTTTATTACAACTATTATTAATATACGAATTAATAATTTATCA TTTGATCAAATACCATTATTTATTTGAGCTGTCGGAATTACAGCCTTATTATTATTACTTTCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCTGCCGGTGGAGGAGATCCTATTTTATATCAACATTTATTT Furthermore, in our previously published nuclear tree that was based on a small number of specimens (Zhang et al. 2023 d), the lectotype of A. toxeus was sister to all other included specimens of C. albociliatus (even of other subspecies), albeit with a non-significant bootstrap support of 15 % (fig. 8 a in Zhang et al. 2023 d). However, with additional specimens sequenced and the quality of the A. toxeus lectotype dataset improved by the second sequencing, it is now positioned within C. albociliatus albociliatus specimens (Fig. 57 magenta within blue), sister to one specimen from Mexico: Oaxaca with 74 % bootstrap support in the nuclear genome tree (Fig. 57 a). Although not sufficient for a confident conclusion, mainly because other specimens from Oaxaca are scattered throughout the phylogenetic tree, this position of the A. toxeus lectotype suggests that it might have been collected in Oaxaca. The collector of the lectotype, Ferdinand Deppe, indeed collected in Oaxaca, among several other places in southern Mexico (e. g., Veracruz) (Stresemann 1954). Moreover, the holotype of Apyrrothrix araxes cyrillus (Plötz, 1879), also collected by Deppe, is from Oaxaca. Additional genomic sequencing, coupled with population-level analysis of these datasets, may provide a more definitive answer regarding the provenance of the A. toxeus lectotype.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B387240FE28FC1AAA9BF86C.taxon	description	http: // zoobank. org / D 77594 CE-FE 05 - 4 EF 4 - 94 B 2 - 5 B 45443632 F 7 (Figs. 58 part, 59)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B387240FE28FC1AAA9BF86C.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Bohart Museum of Entomology, University of California, Davis, CA, USA (UCDC), illustrated in Fig. 59 a, bears the following five printed rectangular labels, four white: [Merida | Libertador | Merida VZLA | VII 3 1979], [J McLaughlin | A A Grigarick | R O Schuster | R W Brooks], [Urbanus elmina Evans, 1952 | female | Det. A. D. Warren, 2000], [DNA sample ID: | NVG- 19064 C 09 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Urbanus (Urbanoides) elma Grishin]. Paratype: 1 ♂ NVG- 24019 F 07 Colombia (no details), 1901, Stichel [SMF] (Fig. 59 b). Type locality. Venezuela: Merida, Libertador, Merida.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B387240FE28FC1AAA9BF86C.taxon	etymology	Etymology. The name is formed from the name of its sister species, U. elmina, made shorter to indicate the more northern distribution of the new species. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B387240FE28FC1AAA9BF86C.taxon	distribution	Distribution. Currently known from Colombia and Venezuela.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B367246FEE1FF14AC1CFBC8.taxon	discussion	Eudamus hopfferi Plötz, 1881 was described from an unstated number of specimens that also included specimen (s) considered by Herrich-Schäffer (1869) to be a variation of Eudamus alector C. Felder & R. Felder, 1867 (type locality Colombia: Bogota) (now Telegonus alector alector, see below) with the white forewing band reduced to a smear, and the locality for these specimens was given as “ Süd-America ” (South America) (Plötz 1881). The type specimens of E. hopfferi labeled as such are unknown. Our search in the MFNB collection for Herrich-Schäffer specimens (Herrich-Schäffer Hesperiidae are mostly in MFNB) matching the description was unsuccessful. However, inspecting an unpublished manuscript by Plötz in ZSMC dated 1876, which is an earlier version of his published Hesperiidae keys, we found additional information about E. hopfferi (Fig. 60 c): “ Mus. Berol. 4969 ”, which is a reference to a specimen lot in MFNB with the number 4969. Plötz identified one (or more) specimen (s) in this lot as E. hopfferi, and therefore, such specimens (when agreeing with the original description) should be considered syntypes. While for many species described by Plötz, these specimen numbers were also listed in the published version of the keys, for E. hopfferi, the MFNB number was not given. The catalog of historical MFNB collections handwritten by the Entomology curator Carl Heinrich Hopffer (died in 1876, before the description of E. hopfferi) contained an entry for the lot 4969 (Fig. 60 d) showing that it was a single specimen collected by Deppe in Mexico and giving the name for it as “ Hesperia phanaeus N. ” Ferdinand Deppe collected in Mexico in 1824 – 1829 (Stresemann 1954), and this specimen should have been collected then. The name “ phanaeus ” was not published, and “ N. ” could be an abbreviation for the Latin “ Nova ” [new] or “ Nobis ” [us], or German “ Neue ”, indicating that the name of the species was new (Zhang et al. 2023 e). Hopffer labeled many Hesperiidae specimens in MFNB that he could not identify with such new names, but most of his names remained unpublished. Such species were subsequently described by other authors, who sometimes kept or modified Hopffer’s names, or proposed unrelated ones. We found the specimen with the number 4969 in MFNB, shown in Fig. 60 a with its labels. The specimen agrees well with the original description of E. hopfferi that we assembled from Plötz’s key and translate as: “ Forewing without a central band on the upper surface. Hindwing not marked with white above. The underside of the forewing is broadly white towards the inner margin and tornus. Above, the body and wing bases are covered with shiny blue and green overscaling. On the underside, the costal margin of the forewing nearly to the apex is reddish-white gray, the white spot [by the tornus] extends very narrowly through the middle cell to the costal margin. Hindwing white at the base by costal margin, otherwise brown with 2 darker crossbands ” (Plötz 1881). Moreover, the published illustration of Telegonus hopfferi in Draudt (1921 – 1924), reproduced here as Fig. 60 b, may be a copy of Plötz’s unpublished (and lost) drawing t [afel]. 88 referenced in the original description and showing syntype (s) of E. hopfferi. Many Hesperiidae illustrations in Draudt (1921 – 1924), especially of obscure and recently described species, were not drawn from specimens, but from their illustrations in other sources, such as Plötz’s unpublished drawings. The illustration and the specimen are similar to each other, not only in the details of wing patterns, but also in the way the specimen was spread. This specimen No. 4969 may be the specimen drawn by Plötz, whose drawing was copied in Draudt (1921 – 1924). As a result of these investigations, we conclude that the specimen No. 4969 is a syntype of E. hopfferi. Its appearance and associated data agree with the original description, unpublished manuscript by the original author, and published early illustrations of this taxon. Moreover, because Plötz did not wish to use the name “ phanaeus, ” likely coined by Hopffer for this new species, it seemed fitting to propose a name honoring Hopffer, who passed away in 1876. That is the year dated on Plötz’s manuscript with the name hopfferi, which was absent from his earlier manuscript (1870, also in ZSMC) that was a list of Hesperiidae species (including unpublished ones) known to Plötz at the time. Finally, the taxonomic identity of this syntype is in agreement with the current and prior use of this name in nearly all primary literature sources (Draudt 1922; Evans 1952; Mielke 2005) because Mexican populations, where this syntype is from, have been associated with this name. To define the taxonomic identity of the name E. hopfferi objectively, N. V. G. hereby designates a syntype in the MFNB collection illustrated in Fig. 60 a, a male with the following three labels (2 nd handwritten and green, others printed and white): [4969], [Phanaeus | N. | Mexico Deppe], and [DNA sample ID: | NVG- 22068 G 07 | c / o Nick V. Grishin] as the lectotype of Eudamus hopfferi Plötz, 1881. The lectotype is missing the tornus of the right hindwing. The COI barcode sequence of the lectotype, sample NVG- 22068 G 07, GenBank PV 550009, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGACTTTTACCTCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGGACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCATCAAGGAGCATCTGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATCACAACAATTATTAATATACGAATTAATAGTTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGAGGAGGAGATCCAATTTTATACCAACACTTATTT As a result of the lectotype designation, the type locality of Eudamus hopfferi becomes Mexico, possibly in south-central or southern Mexico (states of Mexico, Puebla, Oaxaca, and around, but not more eastern territories, such as Veracruz), judging from Deppe’s travels (Stresemann 1954) and genomic sequence comparison that also confirms Thracides uridon Dyar, 1912 (type locality in Mexico: Guerrero, holotype sequenced as NVG- 15101 C 12) as a junior subjective synonym of E. hopfferi (Fig. 61). Finally, it remains unclear why Plötz gave the locality of E. hopfferi as South America even in the original manuscript that listed the Mexican specimen by its number 4969 (Fig. 60 c). It could have been that the locality referred to Herrich-Schäffer specimen (s) — the locality is given in the same line with the reference to them (Plötz 1881), some other specimen (s) Plötz inspected, or it may be an error.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B317246FE02FBAFA8F1FABC.taxon	discussion	Genomic analysis reveals that Eudamus hopfferi Plötz, 1881 (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG- 22068 G 07), currently treated as a subspecies of Telegonus alector (C. Felder & R. Felder, 1867) (type locality Colombia: Bogota), is genetically differentiated from it at the species level (Fig. 61) with Fst / COI barcode difference of 0.32 / 1.7 % (11 bp). Therefore, we propose that Telegonus hopfferi (Plötz, 1881), stat. rest. is a species distinct from Telegonus alector (C. Felder & R. Felder, 1867).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B317247FE8FFA3CAAE2FA36.taxon	description	http: // zoobank. org / 2 CAECE 29 - 3 F 03 - 40 DC- 9 A 82 - 8 D 56 D 3940278 (Figs. 61 part, 62, 63 a – b, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B317247FE8FFA3CAAE2FA36.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 62 (genitalia Fig. 63 a, b), bears the following six printed rectangular labels, five white: [ECUADOR: Esmeraldas: | Río Chuchuví, km. 12.5 Lita- | San Lorenzo rd. 800 - 900 m | 0 ° 53.01 ' N 78 ° 30.90 ' W | III. 2001 I. Aldas leg.], [DNA sample ID: | NVG- 19071 H 10 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 04 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 43 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01588533], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | alector ecuadoricus | Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1 ♂ NVG- 14111 C 04 Ecuador, Imbabura, Rumiñahui, 37 km N of Pedro Vicente Maldonado, elevation 500 m, GPS 0.2788, − 78.9983, Apr- 2001, I. Aldas leg. [USNM]. Type locality. Ecuador: Esmeraldas Province, Río Chuchuví, km 12.5 of Lita – San Lorenzo Road, elevation 800 - 900 m, GPS 0.8835, − 78.5150.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B317247FE8FFA3CAAE2FA36.taxon	etymology	Etymology. The name is given for the type locality and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B317247FE8FFA3CAAE2FA36.taxon	distribution	Distribution. Currently known only from northwestern Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B307259FEF2F9A5AA72FF0B.taxon	discussion	Genomic analysis reveals that Astraptes gilberti H. Freeman, 1969 (type locality in Mexico, San Luis Potosí, holotype sequenced as NVG- 15104 B 08), currently regarded as a junior subjective synonym of Telegonus hopfferi (Plötz, 1881), stat. rest. (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG- 22068 G 07), is in a different clade from several species of Telegonus Hübner, [1819] (type species Papilio talus Cramer, 1777) that include also Telegonus alector (C. Felder & R. Felder, 1867) (type locality Colombia: Bogota) (Fig. 61), and is prominently differentiated from T. hopfferi genetically; e. g., COI barcode difference of 2.6 % (17 bp). Therefore, we propose that Telegonus gilberti (Freeman, 1969), stat. rest. is a species distinct from Telegonus hopfferi (Plötz, 1881), stat. rest. Judging from the specimens we sequenced, T. gilberti ranges from the Río Grande Valley in Texas (USA) through Tamaulipas and Jalisco (Mexico) to Costa Rica.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2E725AFEE5FF6EAA2CFE67.taxon	description	http: // zoobank. org / BCC 4198 A-DEBB- 48 F 6 - 8713 - 4 FECEEF 105 C 9 (Figs. 61 part, 64, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2E725AFEE5FF6EAA2CFE67.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Texas A & M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 64, bears the following five printed (text in italics handwritten) rectangular labels, four white: [TEXAS: | HIDALGO COUNTY | city of Mission | 10 th Street at | irrigation ditch], [coll. | 29 OCT 1971 | Michael A. Rickard], [HESPERIIDAE, | Pyrginae: | Astraptes alector | hopfferi (Plotz, 1882) | det. R. O. Kendall | ♀ (?) M. & B. No. 37], [DNA sample ID: | NVG- 14111 E 04 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | missionus Grishin]. The end of the abdomen of the holotype was probably lost early on, which resulted in Kendall’s questionable determination of its sex (as labeled). The holotype appears to be a male, judging from its more elongated and pointed wings and the lack of white (or at least paler) scaling in the middle of the dorsal forewing characteristic of females in this species group.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2E725AFEE5FF6EAA2CFE67.taxon	etymology	Etymology. The name is given for the type locality in Mission, Texas, and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2E725AFEE5FF6EAA2CFE67.taxon	distribution	Distribution. Currently known only from the holotype collected in the lower Río Grande Valley of Texas, USA. Suggested English name. Mission’s Flasher.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2E725AFEE5FF6EAA2CFE67.taxon	discussion	Comment. The type locality of this species is also the type locality of Spicauda atelis Grishin, 2023, and it may have been around GPS 26.2168, − 98.3311.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2D725BFEEFFE4BADC1FD52.taxon	description	http: // zoobank. org / FC 50 BC 91 - EE 2 B- 40 F 6 - 886 D- 2322607 EB 90 B (Figs. 61 part, 63 c – d, 65, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2D725BFEEFFE4BADC1FD52.taxon	etymology	Etymology. The name is formed from the names of the counties with specimen records Pana [ma] + Ven [ezuela] + us. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2D725BFEEFFE4BADC1FD52.taxon	distribution	Distribution. Currently know from central Panama and Isla de Margarita in Venezuela.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2C725CFE1DFD41A858FC1B.taxon	description	http: // zoobank. org / 758 A 90 B 9 - D 934 - 4077 - 9 A 73 - B 04287 A 124 AD (Figs. 61 part, 63 e – f, 66, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2C725CFE1DFD41A858FC1B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 66 (genitalia Fig. 63 e, f), bears the following five printed rectangular labels, four white: [PERU: Piura: Rio | Pusmalca, 800 m, | 05 o 23 ' S 79 o 37 ' W | & June 2000 | Robbins & Lamas Leg.], [DNA sample ID: | NVG- 14111 C 02 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 06 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 45 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | pacificus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1 ♂ NVG- 14111 C 01 Ecuador, Esmeraldas, km. 18.5 of San Mateo-Puerto Libre Rd., Zapallo hilltop, elevation 500 m, GPS 0.8853, − 79.5450, 28 - 31 - Aug- 2002, J. P. W. Hall & M. A. Solis leg. [USNM]. Type locality. Peru: Piura Region, Río Pusmalca, elevation 800 m, approx. GPS − 5.383, − 79.617.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2C725CFE1DFD41A858FC1B.taxon	etymology	Etymology. The name is given for localities of the type series near the Pacific coast and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2C725CFE1DFD41A858FC1B.taxon	distribution	Distribution. Currently known from near the Pacific coast and the western slopes of the Andes in Ecuador and Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B2B725FFE35FB88ADF1FC7C.taxon	discussion	Papilio creteus Cramer, 1780 (type locality in Suriname) and Papilio parmenides Stoll, 1781 (type locality not stated in the description, likely in Suriname) have been treated as synonyms since Hübner ([1819]) and Herrich-Schäffer (1869), further supported by Godman and Salvin (1893) with the phrase: “ There can be but little doubt that Cramer’s P. creteus is the male of the species he subsequently described as P. parmenides, both types having been obtained in Surinam, ” and reaffirmed by Evans (1952). However, Steinhauser noticed several similar-looking species of Telegonus in the Guianas (unpublished, see below), as confirmed by our genomic analysis. Moreover, the original illustrations of these two species (Cramer 1780; Stoll 1781) differ from each other sufficiently to warrant additional investigation. Published engravings may be rather inaccurate due to the reproduction process. Therefore, we consulted original drawings by Gerrit Wartenaar Lambertz in the library of BMNH, compiled and reproduced here in Fig. 67 a, b. These originals show differences similar to those on published engravings. Papilio creteus has green wing bases and body, pale-yellow palpi beneath, and a paler ventral side of the wing with broader pale-brown bands and lacks a prominently paler streak near the hindwing tornus (Fig. 67 a). Papilio parmenides has bluish green (greener on forewings) wing bases and body, pale bluish palpi beneath, a darker ventral side of wings with narrower paler bands, and a more prominent pale streak (posterior part of the outer paler band) by the hindwing tornus (Fig. 67 a). Due to rounder hindwing tornus, this illustrated specimen (or specimens, it is possible that the dorsal and ventral drawings show different specimens) might have been a female (or females), but not necessarily, because the positioning of wings and possible wing damage (e. g., as in Fig. 67 c) might have caused an artifact in the illustration drawn from a male. We searched for primary type specimens of these taxa. Two males of similarly spread Telegonus were found in RMNH, originally from the Calkoen collection. One of them is illustrated in Fig. 67 c. Among the Calkoen material are a number of Cramer primary type specimens (de Jong 1983). However, these two specimens are labeled from “ Brasilia ” (and not from Suriname as per the description of P. creteus) and differ in several details from the illustrated specimens. While the Lambertz’s drawings are not expected to be particularly accurate, the Calkoen specimens are not as pale beneath as the illustrated P. creteus and their palpi are not pale bluish as in P. parmenides, also mentioned in its original description as (translated): “ The green and blue coloration on both sides of head ” (Stoll 1781). However, the Calkoen specimens were collected at approximately the same time as the types, and they are spread similarly. Being darker beneath with narrower paler bands and better developed pale streak by the ventral hindwing tornus, they are more similar to the drawings of P. parmenides than P. creteus. Because the locality of P. parmenides was not mentioned in the original description, it is even possible that the Calkoen specimens from Brazil might have been syntypes of P. parmenides, if there were several syntypes, but probably not the syntype (s) illustrated by Lambertz. Further analysis reveals that these two Calkoen specimens are conspecific with the specimen from Guyana (NVG- 15039 E 06) in MGCL selected by Steinhauser as a candidate neotype of P. parmenides that remained unpublished. Moreover, this species is present in Suriname, as evidenced by a more recently collected specimen NVG- 22078 G 06 (MGCL) shown in Fig. 67 d. We do disagree that the specimen selected by Steinhauser is the best candidate for the neotype of P. parmenides, mainly because it is from Guyana and not from Suriname, and it differs from the original drawing in the following characters: bluish-green overscaling on both wings is about the same color in the specimen, while the drawing shows distinctly greener forewings and bluer hindwing (coloration we observed in some specimens of Telegonus); its palpi are not as green beneath as in the drawing (although with green scales); and the pale streak near the tornus of the ventral hindwing is not as pronounced as in the drawing. Nevertheless, the evidence assembled above argues that Calkoen specimens from Brazil, the candidate neotype by Steinhauser from Guyana, and a male from Suriname may indeed represent the original P. parmenides. Therefore, we presently apply the name Papilio parmenides Stoll, 1781 to the species represented by NVG- 15039 E 06 and NVG- 22078 G 06 (Fig. 67 d) and are searching for a specimen (not necessarily of the same species) that agrees best with all available information about this taxon to be designated as its neotype. Male genitalia of this species are shown in Fig. 68 k – s and are characterized by a concave costa of the valva and a distally pointed, but not strongly elongated harpe with a relatively straight dorsodistal margin that is not concave but with a vestigial hump in the middle.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B287250FE9EFC66ACEFFC68.taxon	discussion	Evans (1952) treated Eudamus bifascia Herrich-Schäffer, 1869 (type locality in tropical America to USA, likely in Brazil, as evidenced by genomic sequencing, syntype sequenced as NVG- 15031 C 04) and Astraptes latimargo tinda Evans, 1952 (type locality in Brazil: Pará) as subspecies of Telegonus latimargo (Herrich-Schäffer, 1869) (type locality in tropical America to USA, lectotype sequenced as NVG- 15031 C 08), but he misidentified both E. bifascia and T. latimargo. According to the genomic analysis (Fig. 61) and phenotypic inspection of the E. bifascia syntype, it is a species closely related to Telegonus siges Mabille, 1903 (type locality in Brazil, specimens known from South Brazil), with the latter taxon placed as a subspecies of the former in the next section. Specimens that Evans misidentified as “ Astraptes latimargo bifascia ” belong to several undescribed species, some of which are discussed below. The syntype of E. bifascia we sequenced is labeled as a type specimen of this taxon, is from the Herrich-Schäffer collection according to its labels, and matches the original description, parts of which we assemble from the identification keys and translate as: “ Underside with a faintly paler outer-marginal quarter to [outer-marginal] sixth [of the wing’s width]. Fringes brown, underside with two broad darker irregular transverse bands through all wings. ” Therefore, we agree that this specimen is a syntype. To stabilize nomenclature and define the name E. bifascia objectively, N. V. G. hereby designates this syntype in the MFNB collection with the following eleven rectangular labels (1 st purple, 9 th yellow, others white): [Origin.], [Eudamus bifascia HS | N. W. 16 Bras. Pr. 24], [Coll. H. – Sch.], [Teleg. Bifascia | HS.], [Bifascia H-Sch.], [14: 23.], [Allyn Museum Photo | No. 830113 / 7,8, | 9,13,14], [Genit. Prep. | SRS- 1077], [Zool. Mus. | Berlin], [{QR Code} http: // coll. mfn-berlin. de / u / | 940 b 09], and [DNA sample ID: | NVG- 15031 C 04 | c / o Nick V. Grishin] as the lectotype of Eudamus bifascia Herrich-Schäffer, 1869. The lectotype has a chipped outer margin of the left forewing at about its middle and a deep tear stemming from it. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15031 C 04, GenBank PV 550014, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGTACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGTGATGATCAAATTTACAATACT ATTGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTTTCATCTAATATTGC CCACCAAGGAGCATCAGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACCT CATTTTTTGACCCCGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT Genomic sequencing agrees with the label stating “ Bras [il]. ” and places the lectotype with the specimens from Brazil, which is a likely type locality that we should be able to narrow down further by sequencing additional specimens. The label [14: 23.] corresponds to the number for Telegonus cretellus (Herrich-Schäffer, 1869) (type locality in Jamaica as deduced by genomic sequencing and phenotypic comparison (Zhang et al. 2022 b )) in Mabille’s catalog, where the locality for T. cretellus is given as “ Brésil ” (Mabille 1903). This label was not photographed by Hermier before our analysis, and it was not on the T. cretellus lectotype either at that time. This label might have fallen off another cretellus - like specimen and been placed on the E. bifascia lectotype by mistake. According to the genomic analysis (Fig. 61) and phenotypic inspection of the Eudamus latimargo lectotype (see below) and comparing it with the specimens that Evans identified as such, Evans’s “ Astraptes latimargo latimargo ” is not this species but is conspecific with the lectotype of Thymele grullus Mabille, 1888 (type locality in Panama: Chiriquí, sequenced as NVG- 15031 B 12), a species-level taxon and not, as currently considered, a synonym of Telegonus latimargo (see below). Thus, inspecting the genomic trees, we see that Telegonus bifascia (Herrich-Schäffer, 1869), stat. conf., Telegonus tinda (Evans, 1952), stat. conf., and Telegonus latimargo (Herrich-Schäffer, 1869) belong to three different species groups (Figs. 61, 89) and are valid species that are strongly different from each other genetically.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B277251FF7CFC73A880FDFB.taxon	discussion	Similarly to Papilio parmenides Stoll, 1781 (type locality not stated in the original description, likely in Suriname) analyzed above, falling short of the neotype designation for Papilio creteus Cramer, 1780 (type locality in Suriname) and pending further studies, we tentatively identify P. creteus consistently with Steinhauser (unpublished, specimens identified by Steinhauser as P. creteus sequenced from several collections). Male genitalia of this species are shown in Fig. 68 a – j and are characterized by a straight or bisinuate costa of the valva formed by an expanded anteriad and stronger sclerotized ampulla, and a distally more rounded and not strongly elongated harpe with a relatively straight dorsodistal margin without a hump in the middle. This is the species Evans (1952) misidentified as “ Astraptes chiriquensis oenander ” (in part, see below). Assuming that our identification of P. creteus is correct, genomic analysis reveals that P. parmenides and the following taxa treated by Evans (1952) as subspecies of “ Astraptes creteus ”, currently in the genus Telegonus Hübner, [1819] (type species Papilio talus Cramer, 1777), i. e., Telegonus siges Mabille, 1903 (type locality in Brazil), Astraptes creteus crana Evans, 1952 (type locality Guatemala: San Gerónimo), and Astraptes creteus cyprus Evans, 1952 (type locality in Bolivia) are genetically differentiated from each other at the species level and are placed in different clades of the phylogenetic trees (Fig. 61). They are also distinct from other taxa, and among them, only T. siges is rather closely related to another named species, Telegonus bifascia (Herrich-Schäffer, 1869) (type locality in Tropical America to USA, likely Southeast Brazil as evidenced by our genomic sequencing) (Fig. 61) that Evans (1952) misidentified (see previous section): COI barcode difference of 0.8 % (5 bp). Telegonus bifascia and T. siges do not separate into distinct clades in our nuclear genome trees, do not strongly differ genetically with Fst / Gmin of 0.06 / 0.05, and, pending further studies, the latter taxon may be regarded as a subspecies of the former due to some genetic differentiation between them (Fig. 61). Therefore, we propose to treat Telegonus parmenides (Stoll, 1781), stat. rest., Telegonus bifascia siges Mabille, 1903, comb. nov., Telegonus crana (Evans, 1952), stat. nov., and Telegonus cyprus (Evans, 1952), stat. nov. as taxa distinct from Telegonus creteus (Cramer, 1780). We also find that Astraptes creteus crilla Evans, 1952 (type locality Ecuador: Zamora) is in a different clade from Telegonus creteus (Cramer, 1780) and instead is closely related to Telegonus cyprus (Evans, 1952), stat. nov. (Fig. 61). The two names A. creteus cyprus and A. creteus crilla were proposed at the same rank in the same work issued on the same date (Evans 1952). As the first reviser, we gave precedence to A. creteus cyprus above, and, therefore, conservatively place A. creteus crilla as its subspecies, Telegonus cyprus crilla (Evans, 1952), comb. nov., pending further studies of additional specimens. Male genitalia of the T. cyprus crilla specimen we sequenced are shown in Fig. 63 k, l, and are typical for the group in having a concave costa of the valva, a dorsally protruding ampulla separated from the dorsal process of the harpe by a narrow gap, and a distally pointed harpe with a concave dorsoposterior margin.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B267252FE1DFDF9A8A5FD37.taxon	discussion	Eudamus oenander was described by Hewitson (1876) from an unstated number of specimens from Pará, Brazil, in the Staudinger collection. The description is short, and its major part, written in English that expands on the Latin preamble, is quoted here in its entirety: “ Upperside rufous-brown, the base of both wings blue. Underside rufous-brown. Anterior wing with the costal margin blue from the base to the middle, the inner margin broadly white. Posterior wing lobed, darker at the middle, followed by a band of paler colour. Exp. 1 6 / 10 inch. Hab. Pará. In the collection of Dr. Staudinger. ” This description likely refers to a single specimen, because no others were mentioned, and a single measure (not a range) is given for wingspan. Nevertheless, avoiding the assumption of the holotype to follow the ICZN Code Recommendation 73 F (ICZN 1999), we consider any type specimens of E. oenander to be syntypes. No known E. oenander syntypes have been reported (Evans 1952; Steinhauser 1987). If they are still extant, they could be in MFNB (most likely) and possibly in ZSMC, or even MTD (the least likely possibility), where the specimens from the Staudinger collection are currently housed. N. V. G. searched for the syntypes of E. oenander in Hesperiidae holdings of these three collections, including unsorted material. Known Hewitson syntypes in the Staudinger collection bear a label with a single word in Hewitson’s handwriting: the taxon name. For instance, a male syntype of Eudamus aegiochus Hewitson, 1876 (currently in the genus Celaenorrhinus Hübner, [1819]), described in the same publication with E. oenander, is housed in the MFNB collection, and bears such a label “ AEgiochus ”. Syntypes of E. oenander were not found, and we proceeded to figure out the taxonomic identity of E. oenander from its description and other publications. Williams and Bell (1934) synonymized E. oenander with Telegonus creteus (Cramer, 1780) (type locality in Suriname): “ The description of oenander indicates a typical creteus, of which, Capt. Riley informs us, there is no specimen in the Hewitson Collection, nor is there any specimen under the name oenander. ” Evans (1952) treated E. oenander as “ Astraptes chiriquensis oenander ”, also placing it with species currently in the genus Telegonus Hübner, [1819] (type species Papilio talus Cramer, 1777). However, according to the original description, E. oenander is a medium-sized species, about 4 cm in wingspan (1 6 / 10 inches). Even if it is spread with forewings pulled up to minimize the wingspan, specimens of Telegonus are rarely this small (e. g., some T. parmenides). Furthermore, the description does not match Telegonus in its details, e. g., we are yet to find a Telegonus specimen with the blue along the forewing costa beneath reaching its middle, rarely its third, and the ventral hindwing is typically with two variously developed bands, not “ darker in the middle ” with the paler band distad of the darker area. Therefore, judging from the specimen size, blue wing bases above, forewing beneath with blue costa to its middle and large white tornal area, and lobed hindwing beneath with central dark area with a paler band distad, E. oenander could have been a species of Ectomis Mabille, 1878, Aroma Evans, 1955, or possibly some other medium-sized species in this mimicry complex. Several known Ectomis species (e. g., Ectomis bahiana (Herrich-Schäffer, 1869) and males of Ectomis pervivax (Hübner, [1819] )) agree with Hewitson’s description, but they also have bluish ventral hindwing bases, and at least a trace of a white spot in the middle of the ventral forewing costal margin. These two obvious characters were not mentioned in the original description, and therefore, it is less likely that E. oenander belongs to Ectomis. Conversely, Aroma aroma (Hewitson, 1867) (type locality in Brazil: Pará) agrees with the description nearly perfectly, and Eudamus oenander may be this species, re-described by Hewitson from the same locality nearly a decade later. Moreover, another species of Aroma was proposed by Staudinger (1875) in the genus Telegonus as T. henricus, highlighting similarities in appearance between these species as a source of confusion about their classification. Therefore, we propose to treat Eudamus oenander Hewitson, 1876 as a junior subjective synonym of Aroma aroma (Hewitson, 1867), new synonym placement, while we continue our search for syntypes of this taxon. We conclude that E. oenander does not belong to Telegonus, and Evans (1952) misidentified this species. We employ the name Telegonus creteus (Cramer, 1780) (type locality in Suriname) for some specimens that Evans (1952) identified as “ Astraptes chiriquensis oenander ” because out of all Telegonus species currently known from the Guianas, these specimens match best the original description and illustrations of T. creteus. Furthermore, the name of the species Evans (1952) identified as “ Astraptes creteus creteus ” is Telegonus parmenides (Stoll, 1781) (type locality in Suriname), according to our investigation presented above. Evans (1952) treated T. parmenides as a junior subjective synonym of his “ A. creteus creteus ”.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B257253FEF7FCB2AA85FABB.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that many specimens formerly identified as Telegonus hopfferi (Plötz, 1881) (type locality in Mexico, likely south-central or southern, lectotype sequenced as NVG- 22068 G 07) are either Telegonus gilberti (H. Freeman, 1969) (type locality in Mexico, San Luis Potosí, holotype sequenced as NVG- 15104 B 08) or closer related to T. gilberti than to T. hopfferi in the Z chromosome and the mitochondrial genome trees (Fig. 61 b, c). Among them, several specimens from the Amazonian region are not in the same clade as T. gilberti but are sister to the clade consisting of Telegonus bifascia bifascia (Herrich-Schäffer, 1869) (type locality in tropical America to USA, likely in Brazil, as evidenced by genomic sequencing of the lectotype NVG- 15031 C 04) and Telegonus bifascia siges Mabille, 1903, comb. nov. (type locality in Brazil) in the nuclear genome (Fig. 61 a, b) being genetically differentiated from them at the species level and not monophyletic with them in the mitochondrial genome tree (Fig. 61 c) with a COI barcode difference of 1.1 % (7 bp). Therefore, they represent a new species. Curiously, T. bifascia, the closest relative according to the nuclear genome (Fig. 61 a, b), lacks the white area along the costal margin at the base of the ventral hindwing characteristic of the new species. This species keys to “ Astraptes alector hopfferi ” C. 14.26 (a) in Evans (1952) and while having greener rather than bluer overscaling at the wing bases and body above, is darker beneath with the white overscaling much restricted or absent along the forewing costal margin, the central white band is more like a tornal spot, typically not entering the discal cell in males (one paratype has a small whitish cell spot near its posterior end), the greenish area extends farther distad in the discal cell and along the inner margin than along the costal margin, while bluish extends the longest along the costal margin in T. panavenus sp. n. (see above) and about the same level as in the discal cell in other close relatives; no traces of subapical forewing pale spots beneath (or above), but some males have a diffuse paler spot in the middle of the dorsal forewing; females are with such a spot, which may be paler and larger, trapezoidal in the cell CuA 1 - CuA 2 with traces of paler areas in the discal cell and the cell CuA 2 - 1 A + 2 A, and the forewing beneath is with a white spot in the posterior half of the discal cell. The ampulla is narrower and closer associated with the dorsal process of harpe; this process is more robust (Fig. 63 h). Due to the cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 3319.1.3: C 45 T, aly 3762.23.7: G 168 A, aly 3762. 23.7: T 150 C, aly 15386.1.1: C 516 A, aly 15386.1.1: T 531 A; and COI barcode: T 49 A, T 145 C, C 349 C, T 355 T, T 361 T, T 424 T. Barcode sequence of the holotype. Sample NVG- 14111 C 03, GenBank PV 550015, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCATTAAGATTACTTATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCATTTATCATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATAATAGGAGCCCCTGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCTCTCTCATCTAATATTGC CCACCAAGGAGCATCAGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAGATTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCTTTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATCTAAATACCT CATTTTTTGACCCCGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B257253FEF7FCB2AA85FABB.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 69 (genitalia Fig. 63 g, h), bears the following six rectangular labels (2 nd handwritten and others printed), five white: [BRASIL: Rondonia | 62 km S Ariquemes | Faz. Rancho Grande 165 m | 10 ° 53 ' S, 62 ° 80 ' W. 19 - 29. | Sept. 1996. B. Harris], [Astraptes | alector], [DNA sample ID: | NVG- 14111 C 03 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 07 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 46 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | amazonicus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 10 ♂♂ and 5 ♀♀: Brazil, Rondônia, 62 km S of Ariquemes, linha C- 20, Fazenda Rancho Grande, G. T. Austin leg. [MGCL]: 1 ♂ NVG- 24073 H 10 linha C- 20, 10 km E of B- 65, 3 km E of, 18 - Nov- 1992 and 1 ♂ NVG- 24073 H 11 7 km E of B- 65, 14 - Nov- 1992; 1 ♀ NVG- 24033 H 09 Pará, 1896, Donckier leg. [MFNB]; and Amazonas: 1 ♂ NVG- 24073 H 09 Maués, Rio Apoquitaua, Feb- 1999, M. Simon leg. [MGCL]; 1 ♂ NVG- 24034 B 05 Massauari, old, Hahnel leg. [MFNB]; and 1 ♂ NVG- 24034 B 03 Tefé, old, Hahnel leg. [MFNB]; 1 ♀ NVG- 21115 D 05 Suriname, Berg en Dal, 1873, L. leg. (we were not able to deduce the name behind the abbreviation “ L. ”) [MFNB]; 1 ♀ NVG- 14111 B 11, USNMENT 00275055 Guyana, Eastern Kanuku Mountains, Two Hat Mountain south slope, elevation 850 ' – 1200 ', GPS 3.1133, − 59.0983, 21 - 28 - Sep- 2000, S. Fratello et al. leg. [USNM]; 1 ♀ NVG- 24073 G 02 Venezuela, Amazonas, Puerto Ayacucho, 29 - Aug- 1999, M. Simon leg. [MGCL]; 1 ♂ NVG- 14111 B 10 Colombia, Caquetá Department, La Montañita, elevation 350 m, 27 - Jan- 1971, S. S. & S. Nicolay leg. [USNM]; Ecuador: 1 ♂ NVG- 19071 H 06, USNMENT 01588529 Napo Province, Misahualli Jungle Lodge, elevation 450 m, GPS − 1.0257, − 77.6570, 6 - 8 - Jan- 2002, J. P. W. Hall & M. A. Solis leg. [USNM] and 1 ♀ NVG- 24034 B 06 Pastaza Province, Sarayacu, old [MFNB]; Peru: 1 ♂ NVG- 19071 H 07, USNMENT 01588530 Loreto Region, 25 mi E of Iquitos, Amazon River, Explorama Inn, elevation 200 m, 17 - 21 - Sep- 1990, Ron Leuschner leg. [USNM] and 1 ♂ NVG- 24074 A 02, Huánuco, Tingo María, ca. 2007, E. C. Knudson leg. [MGCL]; and 1 ♂ NVG- 24034 B 04 Bolivia, Beni, Puerto San Mateo, 1891, Garlepp leg. [MFNB]. Type locality. Brazil: Rondônia, 62 km south of Ariquemes, linha C- 20, 7 km east of B- 65, Fazenda Rancho Grande, elevation 165 m, approx. GPS − 10.53, − 62.80.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B257253FEF7FCB2AA85FABB.taxon	etymology	Etymology. The name is derived from the distribution of this species confined to the Amazonian Region. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B257253FEF7FCB2AA85FABB.taxon	distribution	Distribution. The Amazonian Region, broadly in all countries.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B237255FE15FFFEAD90FEEE.taxon	description	http: // zoobank. org / F 10 DDFE 4 - 038 B- 40 DF- 94 D 0 - FE 6 F 2 DAE 6772 (Figs. 61 part, 63 i – j, 70, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B237255FE15FFFEAD90FEEE.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 70 (genitalia Fig. 63 i, j), bears the following five printed rectangular labels, four white: [PANAMA: Darien | Cana 1550 m | 5. VI. 1983 | Leg. G. B. Small], [DNA sample ID: | NVG- 14111 D 04 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 08 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 47 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | pallidus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Panama: Darién Province, Cana, elevation 1550 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B237255FE15FFFEAD90FEEE.taxon	etymology	Etymology. The name is given for the paler aspect of this species compared to its relatives. The name is a masculine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B237255FE15FFFEAD90FEEE.taxon	distribution	Distribution. Currently known only from the holotype collected in eastern Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B227256FEE5FEFDA801FD1C.taxon	description	http: // zoobank. org / 11069080 - 89 AE- 4111 - 8603 - 86 E 70 A 3 E 775 B (Figs. 61 part, 63 m – o, 71, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B227256FEE5FEFDA801FD1C.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 71 (genitalia Fig. 63 m – o), bears the following six printed (text in italics handwritten) rectangular labels, five white: [Brazil, S. Catarina | Joinville 200 m. | March 13 - 14, 1984 | McInnis, Coll.], [Genit. Vial | SRS- 3219], [Telemachus bifascia | (Herrich-Schäffer, 1869) | ♂ | Det. S. R. Steinhauser], [CV Covell colln. | MGCL Acc. | 2006 - 9], [DNA sample ID: | NVG- 22078 G 12 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | subfuscus Grishin]. Paratype: 1 ♀ NVG- 23063 F 09 Brazil, Espirito Santo, Santa Teresa, elevation 800 m, 13 - 15 - Feb- 1972, C. Callaghan leg., genitalia vial SRS- 1801 [MGCL]. Type locality. Brazil: Santa Catarina, Joinville, elevation 200 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B227256FEE5FEFDA801FD1C.taxon	etymology	Etymology. The name is given for the ventral side (sub -) being darker (fuscus) than in its relatives. The name is a masculine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B227256FEE5FEFDA801FD1C.taxon	distribution	Distribution. South Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B227256FEE5FEFDA801FD1C.taxon	discussion	Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus. ” Here, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus ” for nomenclatural purposes. Thus, we consider this name to be unpublished.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B217268FE17FC83ABF2FBFE.taxon	discussion	The name Eudamus blasius Plötz, 1881 (type locality listed as “ Cuba ”, likely in Southeast or South Brazil) was proposed to include specimens that Herrich-Schäffer (1869) had identified as Goniloba elorus (Hewitson, 1867), but which Plötz (1881) suggested were misidentified. However, Godman (1907) who inspected the unpublished and now likely lost original drawing by Plötz of E. blasius syntype (taf [el]. 93), decided that it was conspecific with Telegonus (Rhabdoides) elorus (Hewitson, 1867) (type locality in Brazil, likely Southeast or South). Since then, the name blasius has been treated as a junior subjective synonym of T. elorus in most publications (Evans 1952; Mielke 2005). Skinner and Ramsden (1923) doubted the type locality “ Cuba ” given by Plötz for E. blasius because no specimens matching the original description were known from Cuba. Specimens agreeing with the description are only known from Southeast and South Brazil. To learn more about E. blasius, we interpretively translate its original description, assembling relevant sections of the key given by Plötz (1881): “ the body and wing bases are blue or green above; forewing beneath lacks a white spot near mid-costa and is brown [not blue] at the base; ventral side of all wings is light brown along the margin and sharply bordered by a dark brown postdiscal band; tornus of the hindwing beneath is shaded dull brown up to vein 2 [i. e., CuA 2]. ” We regard these as characters to differentiate E. blasius from other taxa. To gain further insights, we searched for E. blasius syntypes among Hesperiidae holdings in all major collections that are listed in the Acknowledgments section. We focused on the MFNB collection, which contains many primary types of Plötz and Herrich-Schäffer. Several specimens in MFNB bear the identification label “ blasius ” but none has a label characteristic of specimens from the Herrich-Schäffer collection and can be directly linked with it. One of these specimens is also labeled as “ Typus. ” However, according to its labels, this specimen from the Weymer collection was collected in 1894, which is after the original description of E. blasius, and, therefore, is not a syntype. This is most likely a specimen of Telegonus blasius mentioned by Weymer (1895), according to whom, it was from Rio Grande do Sul in Brazil. This specimen mostly agrees with the original description of E. blasius, particularly in exhibiting a strong contrast between the paler wing margins beneath and a postdiscal dark band, but it does not have a prominently darker ventral hindwing tornus up to vein CuA 2. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The second specimen (Fig. 72 b) labeled as “ blasius ” is also from the Weymer collection and agrees less with the original description due to weaker contrast between the submarginal pale and postdiscal brown, but it has a darker tornus. The third specimen (Fig. 72 a) bears a label characteristic of many Plötz’s type specimens, penciled on a yellowing paper “ blasius Pl. (elorus H-Sch nec Hew.) ” and agrees best with the original description of E. blasius both in having a strong contrast between pale margins and dark bands on both wings beneath and a darker tornus bordered precisely by the vein CuA 2 on the ventral hindwing. This is an old specimen with “ repair ” characteristic of century-old specimens when pieces of wings of some other specimens were glued on to cover missing parts of wings: both wings are repaired at the tornus from beneath. However, this specimen lacks any labels linking it to Herrich-Schäffer or Plötz directly. Judging from its age, agreement with the original description of E. blasius, and its identification label, it is possible that this specimen is a syntype of E. blasius. However, we do not have strong evidence to support this hypothesis. Therefore, we consider that syntypes of E. blasius are either lost or are unrecognizable. Genomic sequencing reveals that at least two similar-looking species have been identified as T. elorus, of which E. blasius is considered a junior subjective synonym. Therefore, in the absence of credible syntypes of E. blasius, there is an exceptional need for the neotype to define this taxon objectively due to its almost certainly incorrect type locality, “ Cuba, ” and currently unrecognized species present among its relatives. Hereby, N. V. G. designates the specimen in MFNB illustrated in Fig. 72 a (DNA sample NVG- 24028 D 10) as the neotype of Eudamus blasius Plötz, 1881. This neotype corroborates the current and long-standing treatment of the name as a junior subjective synonym of Telegonus (Rhabdoides) elorus (Hewitson, 1867) (Godman 1907; Evans 1952; Mielke 2005) and thus stabilizes nomenclature as it is applied today. This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of E. blasius, which is necessary because a new species is present among its close relatives; 75.3.2. The characters to differentiate this taxon from others are stated in the original description (Plötz 1881) and are: the body and wing bases are blue or green above; ventral forewing below without a white spot near mid-costa, brown (not blue) at the base; fringes of the hindwing are narrowly whitish; ventral side of all wings is light brown along the margin and sharply bordered by a dark brown postdiscal band; tornus of the hindwing beneath is shaded dull brown up to vein CuA 2; 75.3.3. The neotype specimen is a male bearing three labels (1 st handwritten, others printed): [blasius Pl. | (elorus H-Sch | nec Hew.)], [DNA sample ID: | NVG- 24028 D 10 | c / o Nick V. Grishin], [{QR Code} MfN URI | http: // coll. mfn- | berlin. de / u / | 09 f 692] and illustrated in Fig. 72 a; the neotype is missing the right antenna and has a tornus repaired from the ventral side on both hindwings; pieces of wings of other specimen (s) glued to the neotype to repair it are hereby excluded from the neotype; 75.3.4. We failed to find definitive syntypes of E. blasius among Hesperiidae holdings in all collections we visited (see Acknowledgments for their list) and, therefore, believe that they were lost, although it is possible that the neotype itself might have been a syntype; 75.3.5. The neotype agrees with the original description (Plötz 1881) and information about E. blasius from other sources (Herrich-Schäffer 1869; Godman 1907), as evidenced by observing the characters of this taxon listed above (75.3.2.) in the neotype photographs (Fig. 72 a); 75.3.6. The neotype is lacking a locality label and the original type locality given as “ Cuba ” is almost certainly incorrect, thus both the neotype and syntypes are from an unknown locality; and the neotype is a specimen collected around the same time as syntypes, is in the collection where many primary type specimens of Plötz and Herrich-Schäffer are deposited, and might even be a syntype; 75.3.7. The neotype is in the Museum für Naturkunde, Berlin, Germany (MFNB). As a result of the neotype designation, the type locality of E. blasius becomes Southeast or South Brazil, as determined by genomic comparisons, and is to be refined further by sequencing of additional specimens. The COI barcode sequence of the neotype, sample NVG- 24028 D 10, GenBank PV 550018, 658 base pairs, is: AACTCTATATTTTATTTTTGGAATTTGAGCAGGATTAATCGGAACTTCTTTAAGATTACTTATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGACGATCAAATTTATAACACC ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTCTAATAATAGGAGCCCCTGATATAGCTTTTCCACGTA TAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTTTATTAATTTCAAGAAGAATTGTCGAAAATGGTGCTGGTACAGGATGAACAGTTTATCCCCCTCTTTCATCAAATATTGC CCATCAAGGAGCATCAGTTGACTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAATAACTTATCT TTTGATCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTATTATTATTACTTTCACTACCAGTTTTAGCAGGAGCTATTACTATATTATTAACTGATCGAAATTTAAATACCT CATTTTTTGATCCAGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1F7269FE18FBE2AD6CFE5C.taxon	description	http: // zoobank. org / F 15033 DB-BF 2 C- 4 B 5 F-AF 48 - 6025370630 A 7 (Figs. 61 part, 72 b, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1F7269FE18FBE2AD6CFE5C.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 72 b, bears the following six rectangular labels (first two handwritten, others printed), five white: [Blasius | Plötz. no 56 | taf. 93], [14: 12.], [Coll. Weymer], [DNA sample ID: | NVG- 24028 D 11 | c / o Nick V. Grishin], [{QR Code} MfN URI | http: // coll. mfn- | berlin. de / u / | 09 c 7 b 8], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | elorianus Grishin]. On the first label, “ taf [el]. 93 ” refers to the number of an unpublished drawing of Eudamus blasius Plötz, 1881 (type locality given as “ Cuba ”, likely in Southeast or South Brazil) by Plötz (1881). The label [14: 12.] corresponds to the number for Telegonus blasius in Mabille’s catalog (1903). Type locality. Not stated on the labels of the holotype, likely in Southeast or Southern Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1F7269FE18FBE2AD6CFE5C.taxon	etymology	Etymology. The name is formed from the name of its sister species, T. elorus, and is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1F7269FE18FBE2AD6CFE5C.taxon	distribution	Distribution. Currently unknown, likely in Southeast and Southern Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1E726BFEEAFE43ADFFFC88.taxon	description	http: // zoobank. org / 528 BEF 25 - DCF 4 - 41 D 3 - B 4 B 9 - 4195 F 6 AC 1 E 24 (Figs. 61 part, 73, 74 a – b, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1E726BFEEAFE43ADFFFC88.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 73 (genitalia Fig. 74 a, b), bears the following five printed (text in italics handwritten) rectangular labels, four white: [PERU: MD 491 m | Amazonia Lodge 2568 | 16. V. 2012 Kinyon], [DNA sample ID: | NVG- 14111 C 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 10 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 49 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | perumazon Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Peru: Madre de Dios, Amazonia Lodge, elevation 491 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1E726BFEEAFE43ADFFFC88.taxon	etymology	Etymology. The name signifies the distribution of this species in the Amazonian region of Peru: Peru + [A] mazon, and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1E726BFEEAFE43ADFFFC88.taxon	distribution	Distribution. Currently known only from the holotype collected in southeastern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B1C726EFEBBFC05ABF2FEBF.taxon	discussion	Telegonus chiriquensis was described from a series of several males and females collected by Heinrich Ribbe in Chiriquí, Panama, with a single (“ somewhat differing ”) specimen from Panama, Panama (Staudinger 1875). Furthermore, Staudinger illustrated T. chiriquensis in a later publication (Staudinger 1884 – 1888). We located syntypes of this species in MFNB (3 ♂♂ and 2 ♀♀ labeled as “ Origin. ”) and ZSMC (1 ♂ and 1 ♀ labeled as “ Paratype ”). Genomic sequencing of several syntypes reveals that the type series of T. chiriquensis is polytypic and consists of at least two species not most closely related to each other (Fig. 61). Phenotypic inspection confirms this conclusion. One specimen (sequenced as NVG- 15031 B 10, Fig. 75 d), which bears the largest number of labels, including “ chiriquensis Stgr ” (likely in Staudinger’s handwriting), “ bifascia H. S ” (possibly in Hewitson’s handwriting), “ Lectotypus ” (probably added by or by the request of Olaf H. H. Mielke), and “ LECTOTYPE ♂ Telegonus | chiriquensis | Staudinger, 1875 | designated by: S. R. Steinhauser ” (added by Steinhauser), is a male conspecific with Thymele grullus Mabille, 1888 (type locality in Panama: Chiriquí, lectotype sequenced as NVG- 15031 B 12), as evidenced by genomic sequencing (Fig. 61). A lectotype designation has not been published for T. chiriquensis, however, Steinhauser (1987) wrote: “ I have examined a syntype of this … taxon from the type series in the ZMHU which I will designate as lectotype in a future paper ” referring to this syntype NVG- 15031 B 10 in MFNB. Other syntypes of T. chiriquensis belong to a species that has been referred to as chiriquensis in most literature, e. g., in Evans (1952). It is unclear why Steinhauser decided to designate this syntype, which is not conspecific with the rest of the type series, as the lectotype. It is possible that it was the only syntype he inspected, not seeing others. This syntype was likely the only one mailed to Steinhauser from Berlin. We believe that Steinhauser worked with this syntype in Sarasota, FL, USA (the Allyn Museum of Entomology location) and not in Berlin, because this specimen carries a label “ Allyn Museum Photo No. 89 / 2 / 3 / 16,17 900102 / 1,2 ” with numbers in italics in Steinhauser’s handwriting indicating that the photo may have been taken in Sarasota, and also a label “ Zool. Mus. Berlin ”, likely added by Steinhauser to keep track of loaned specimens. This syntype was probably selected to be mailed to Sarasota because it was the first one in the series (top left, right below the header label with the name “ chiriquensis | Staudinger ”) and has accumulated the largest number of labels, including the identification label “ chiriquensis Stgr ”. All other syntypes in MFNB, the collection with the largest number of syntypes, only have the following three labels: “ Origin. ”, “ Chiriqui | Ribbe ”, and “ Paralectotypus ”, except one of the females with an additional label “ Telegonus | chiriquensis ” indicating that this was the specimen loaned to Godman and Salvin (1893) as mentioned in their book: “ Dr. Staudinger has kindly lent us his type of this species, and also a male, which he considered to belong to T. elorus of Hewitson. ” Handwriting on this identification label is consistent with that of Godman. A similar-styled label written by the same person is placed on the lectotype of T. grullus, about which Godman and Salvin (1893) wrote: “ the type lent us by Dr. Staudinger ”. From these considerations, we deduce that the female syntype with the label “ Telegonus | chiriquensis ” was considered to be “ his type ” of this species by Staudinger. On the one hand, mentioning this female as “ type ” by Godman and Salvin (1893) does not constitute a lectotype designation according to the ICZN Code Art. 74.6. because the original description of T. chiriquensis mentions more than one specimen, implying that the name was proposed from a series of syntypes (Staudinger 1875). On the other hand, it was Godman and Salvin (1893), and not Mielke and Casagrande (2002), who designated a lectotype of T. grullus by referring to “ the type ” (Art. 74.6.) because the original description had no implications about the number of specimens involved (Mabille 1888). Both designations refer to the same specimen. In summary, our analysis suggests that Staudinger considered the species that is not T. grullus to represent his concept of T. chiriquensis better. This is further evidenced by an illustration of T. chiriquensis in the book that he authored and coedited (Staudinger 1884 – 1888). This illustration, reproduced here in Fig. 75 c, is particularly similar to one of the male specimens in the MFNB collection that is also not T. grullus. The two species can be told apart by the color of the ventral hindwing from the vein 1 A + 2 A to the inner margin (anal fold). The anal fold beneath is entirely brownish in T. grullus (Fig. 75 d right), while it is partly yellow towards the tornus in the other species (Fig. 75 a – c right). Staudinger’s illustration shows an entirely yellow tornus up to the inner margin (Fig. 75 c right), allowing unambiguous selection of the illustrated species from the type series of T. chiriquensis. Moreover, broader wing shape and more interconnected ventral forewing dark bands agree better with the species that is not T. grullus. Furthermore, Staudinger’s illustration shows a brown patch directed toward the tornus within the yellow area along the vein 1 A + 2 A on the ventral hindwing. Only one of the syntypes possesses this patch and otherwise agrees best with the illustration. Finally, the illustrations of T. chiriquensis in Draudt (1922), reproduced here in Fig. 75 b, do not depict T. grullus either, but it is not clear whether they — ventral and dorsal side, possibly of two different specimens due to the wing shape difference: male (ventral) and female (dorsal) — show syntypes or even specimens conspecific with the syntypes of T. chiriquensis. It is conceivable that they are copies of Plötz’s unpublished and possibly lost drawing t. 1342 (Godman 1907) of A. weymeri, which was regarded as a junior subjective synonym of T. chiriquensis by Draudt (1922). For all these reasons, we arrived at the conclusion that this “ future lectotype ” inspected by Steinhauser (which is T. grullus) is not the best choice to represent Staudinger’s concept of T. chiriquensis. We believe that both the historical accuracy (i. e., selecting the species dominant in the type series, which is also the species illustrated in a book by the author of this taxon) and the stability of nomenclature (i. e., the species that has been regarded as T. chiriquensis in the most widely accepted works since the original description, such as Godman and Salvin (1893) and Evans (1952), in part) would be served better by designating a specimen different from the one inspected by Steinhauser as the lectotype of T. chiriquensis. Therefore, to stabilize nomenclature and to select one species out of the polytypic type series, N. V. G. hereby designates a syntype in the MFNB collection, a male illustrated in Fig. 75 a and bearing the following five rectangular labels (1 st purple, 3 rd red, others white): [Origin.], [Chiriqui | Ribbe], [Paralectotypus], [{QR Code} http: // coll. mfn-berlin. de / u / | e 1 f 9 d 5], and [DNA sample ID: | NVG- 24028 C 04 | c / o Nick V. Grishin] as the lectotype of Telegonus chiriquensis Staudinger 1875. The lectotype has a scar on its right forewing dorsal side starting from a chipped outer margin near the apex, directed towards the middle of the inner margin, and reaching the vein CuA 1. The lectotype (Fig. 75 a) resembles Staudinger’s illustration (1884 – 1888) (Fig. 75 c) more than paralectotypes in MFNB (e. g., Fig. 75 d). Moreover, our choice of the species to be selected from the type series as T chiriquensis also makes better use of existing names. If the syntype of T. chiriquensis that is conspecific with T. grullus is selected as the lectotype, then T. grullus would become a junior subjective synonym of T. chiriquensis, but the second species represented by several syntypes of T. chiriquensis would not have an available name associated with it and would become a “ new ” species that needs a name. However, this second species is prevalent in the type series (only one former syntype is conspecific with T. grullus) and, as we discussed above, Staudinger and subsequent literature, including Evans (1952) (in part), regarded this prevalent species as T. chiriquensis. The COI barcode sequence of the lectotype, sample NVG- 24028 C 04, GenBank PV 550021, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTCATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCGTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCACTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B19726FFE1BFE20ABF2FB9A.taxon	discussion	Aethilla weymeri Plötz, 1882 was described from an unstated number of specimens of unknown provenance (Plötz 1882 b). Being absent from the 1876 version in the ZSMC library, this species was added to the manuscript near its publication. Furthermore, Plötz did not specify the number of his drawing for A. weymeri and instead stated “ Nachtr. ” meaning Nachtrag (supplement). It is possible that the drawing was not made at the time of publication. Later, this drawing was given the number 1342, as specified by Godman (1907), who stated that the illustrated specimen was from Chiriquí and selected a specimen from his collection that agreed best with the illustration. This specimen in BMNH bearing a label “ Compared with Plotz’s drawing of weymeri, Plötz ” may serve as a proxy for the lost drawing. It is from Tabasco, Mexico, and has broadly yellow submarginal areas on the ventral hindwings but dark (not yellow, as per the original description) fringes and brighter cyan-blue (rather than dark green in the description) dorsal overscaling. Images of this specimen, photographed by N. V. G., are shown on the Butterflies of America website (Warren et al. 2024). To learn more about A. weymeri, we searched for its syntypes in MFNB, where the Weymer collection is deposited. We reason that Plötz proposed the name to honor Weymer, who might have discovered this species. We found two specimens that match the original description of A. weymeri rather well, e. g., they have dark green (not blue) overscaling at wing bases and body above, pale yellowish-gray palpi beneath, orange-yellow fringes on the hindwing, and a yellow outer marginal area on the ventral hindwing broadest at the tornus. Both specimens bear a label with the name “ victa ”: “ victa m il ” and “ victa Wmr il. ” suggesting that Weymer considered these specimens to be a new species that he wanted to name “ victa ”. On the first specimen, “ m ” stands for “ mihi ” (Latin for “ of me ”), placed after a species name as an attribution of the new species to the writer. This notation was common over a century ago, instead of the author’s name being written directly. On the second specimen, Weymer used the abbreviation of his last name “ Wmr ”. On both specimens, “ il ” is for “ in litteris, ” meaning that the name has not been published. Moreover, a label on the first specimen states “ n sp. 462 Plötz ”, and we interpret it as indicating that Plötz considered the specimen number 462 in Weymer’s collection to be a new species. The first specimen does not have a locality label. The second specimen bears a label “ Central Amer ” and collection year 1887. The second specimen was collected after the description of A. weymeri in 1882 and, therefore, cannot be a syntype. However, we consider the first specimen to be a syntype of A. weymeri, because it matches the original description well, is from Weymer’s collection (thus proposing a patronym would make sense), and has been regarded by Plötz as a new species. We hypothesize that Plötz inspected Weymer’s collection and told him this specimen represented a new species. Weymer decided to propose a name “ victa ” for it. However, this name was not published by Weymer, but Plötz added this species into his key as “ weymeri ” right before publication. The syntype did not have a locality label, and Plötz could not have stated the locality of A. weymeri in his publication. However, later, the second specimen of “ victa ” was collected in Central America, and when Plötz was preparing the drawing, he listed the locality as “ Chiriqui ”. It is possible that other specimens of “ victa ” with the locality “ Chiriqui ” also existed, and maybe they were illustrated by Plötz instead of the syntype. To stabilize nomenclature and define the name A. weymeri objectively, N. V. G. hereby designates this found syntype in the MFNB collection illustrated in Fig. 76 and bearing the following six labels (1 st, 2 nd, and 3 rd handwritten, others printed): [462 | Weymer], [victa m il | n sp. 462 Plötz], [? Aethilla], [Coll. Weymer], [{QR Code} http: // coll. mfn-berlin. de / u / | 44 a 098], [{QR Code} MfN URI | http: // coll. mfn- | berlin. de / u / | 09 f 692], [DNA sample ID: | NVG- 24028 C 11 | c / o Nick V. Grishin] as the lectotype of Aethilla weymeri Plötz, 1882. The first three labels are in Weymer’s handwriting. The lectotype is missing the club of the left antenna, its right antenna overlays the forewing on the dorsal side, and the tornus of its right hindwing is repaired; pieces of wings of other specimen (s) glued to the lectotype to repair it are hereby excluded from the lectotype. The type locality of A. weymeri is likely in Panama: Chiriquí (Godman 1907). Consistently, genomic sequencing places the lectotype among specimens from Central America. The COI barcode sequence of the lectotype, sample NVG- 24028 C 11, GenBank PV 550022, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGATTAATTGGAACTTCTTTAAGATTACTCATTCGAACTGAATTAGGAACCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTAACAGCTCACGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTCCCATTAATAATAGGAGCCCCTGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGACTTTTACCCCCGTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGAACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGC CCATCAAGGAGCATCAGTTGATTTAGCTATTTTTTCCTTACATTTAGCTGGTATTTCCTCTATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAATAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCATTATTATTATTACTTTCACTACCAGTTTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTTGATCCAGCTGGGGGAGGAGATCCAATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B18726FFEC5FB1EAC46FA7A.taxon	discussion	Genomic phylogeny of Telegonus (Rhabdoides) Scudder, 1889 (type species Eudamus cellus Boisduval & Le Conte, [1837]), reveals that the lectotype of Aethilla weymeri Plötz, 1882 (type locality not stated, likely in Panama: Chiriquí, sequenced as NVG- 24028 C 11) is placed among specimens of Telegonus (Rhabdoides) chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí, lectotype sequenced as NVG- 24028 C 04) (Fig. 61). Therefore, we propose that Aethilla weymeri Plötz, 1882 is a junior subjective synonym of Telegonus (Rhabdoides) chiriquensis Staudinger, 1875, as regarded by Evans (1952).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B187261FEF2FA62AA0AFF35.taxon	description	http: // zoobank. org / D 916455 A- 197 F- 41 FF-A 0 B 5 - 1 C 2711054 FDC (Figs. 61 part, 74 c – g, 77, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B187261FEF2FA62AA0AFF35.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 77 (genitalia Fig. 74 c – g), bears the following nine printed (text in italics handwritten) labels (2 nd triangular, others rectangular), seven white: [MEXICO: VERACRUZ | Catemaco | X. 19 72 | T. Escalante], [>, a piece of antenna is glued to this label, no text, [A. C. Allyn | Acc. 1973 - 48], [MGCL / FLMNH | Specimen no. | 16820], [Genit. Vials | SRS - 1836], [Telemachus weymeri | (Plötz, 1882) ♂ | Det. S. R. Steinhauser], [DNA sample ID: | NVG- 23063 E 11 | c / o Nick V. Grishin], one pink without any text, and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | steinhauseri Grishin]. Paratypes: 5 ♂♂ and 5 ♀♀: Mexico: Veracruz: 1 ♀ NVG- 14082 D 02 Presidio, Jun- 1942, T. Escalante leg. [AMNH] and 1 ♀ NVG- 18027 G 11 Santa Rosa, Aug- 1906, Wm. Schaus collection [USNM]; and Oaxaca, Candelaria Loxicha,> 500 m, E. C. Welling leg.: 1 ♂ NVG- 14082 D 03 7 - Nov- 1971 genitalia SRS- 1702 [AMNH]; 1 ♀ NVG- 23063 E 07 2 - Oct- 1969 genitalia SRS- 879 [MGCL]; and 1 ♀ NVG- 23063 E 08 4 - Oct- 1969 [MGCL]; 1 ♂ NVG- 23063 E 12 Guatemala, Santa Rosa, El Naranho, 25 - Jun- 1925, ex coll. E. Le Moult, genitalia SRS- 864 [MGCL]; 1 ♂ NVG- 19075 B 01 Honduras, old. Edw. T. Owen collection, genitalia SRS- 1838 [USNM]; and Panama [USNM]: Canal Zone, Farfan, S. S. Nicolay leg.: 1 ♂ NVG- 14105 A 01, 14 - Feb- 1963 and 1 ♀ NVG- 14105 A 02, 15 - Feb- 1963 and 1 ♂ NVG- 19075 B 04, USNMENT 01588551 Herrera, Cerro Alto Higo, 1000 m, 23 - Dec- 1984, G. B. Small leg. Type locality. Mexico: Veracruz, Catemaco.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B187261FEF2FA62AA0AFF35.taxon	etymology	Etymology. The name, a noun in the genitive case, honors Stephen R. Steinhauser, who made significant contributions to our knowledge of Hesperiidae and had a keen interest in Telegonus but did not have an opportunity to search for syntypes in Berlin and, therefore, did not recognize this species as new.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B187261FEF2FA62AA0AFF35.taxon	distribution	Distribution. From southern Mexico to Colombia and Venezuela.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B187261FEF2FA62AA0AFF35.taxon	discussion	Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus. ” Here, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus ” for nomenclatural purposes. Thus, we consider this name to be unpublished. Furthermore, we note that the unavailable infrasubspecific name Telegonus chiriquensis form godmani Williams, 1927 (see discussion of names by Williams in Zhang et al. (2022 b )) refers to specimens most likely conspecific with this species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B167261FF6EFEB1AA80FC32.taxon	discussion	Genomic analysis reveals that Telegonus chiriquensis erana (Evans, 1952) (type locality in Ecuador: Balzapamba) and Telegonus chiriquensis meretrix (Hewitson, 1876) (type locality in Ecuador) currently treated as subspecies of Telegonus chiriquensis Staudinger, 1875 (type locality in Panama: Chiriquí, lectotype sequenced as NVG- 24028 C 04) are not monophyletic with it and belong to two different clades being strongly differentiated from it genetically (Fig. 61): e. g., COI barcodes in the closest pair (T. chiriquensis erana and T. chiriquensis chiriquensis) differ by 4.1 % (27 bp). Telegonus chiriquensis meretrix belongs to a different species group and is closer related to Telegonus parmenides (Stoll, 1781), stat. rest. and not to Telegonus creteus (Cramer, 1780) as the other two taxa (Fig. 61). Telegonus chiriquensis meretrix is characterized by the blue area on the dorsal forewing reaching the discal brown band (especially along the costal margin) and broad ventral forewing bands. These characters are shared with Telegonus cretatus Hayward, 1939 (type locality also in Ecuador) from the same species group, among several other species, rather than with T. chiriquensis, which has reduced blue-green bases of the forewings. Evans (1952) misidentified E. meretrix in part, and except for three females from Ecuador (with broad blue wing bases), other specimens (with narrow blue-green bases) belong to other species (one described below as new), indeed, closely related to T. chiriquensis. For these reasons, we propose that Telegonus erana (Evans, 1952), stat. nov. and Telegonus meretrix (Hewitson, 1876), stat. rest. are species distinct from Telegonus chiriquensis Staudinger, 1875.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B167262FE14FBB0AA43FACD.taxon	description	http: // zoobank. org / 0 A 995 D 2 A-A 171 - 4311 - A 9 E 1 - 379669 B 6 CC 44 (Figs. 61 part, 74 h – o, 78, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B167262FE14FBB0AA43FACD.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 78 (genitalia Fig. 74 h – l), bears the following eight printed (text in italics handwritten) rectangular labels (5 th pale-blue, last red, and others white): [MEXICO: CHIAPAS | San Antonio | 4000 '; sta. # 4 | 8 - VIII. 197 4 | R. Wind], [Genit. Prep. SRS- 856], [A. C. Allyn | Acc. 1974 - 24], [SRS Database | No. 673], [PARATYPE | Telemachus | draudti | S. R. Steinhauser], [MGCL / FLMNH | Specimen no. | 16922], [DNA sample ID: | NVG- 23063 G 01 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Telegonus (Rhabdoides) | chiapus Grishin]. Paratypes: 2 ♂♂ from Mexico, Chiapas [MGCL]: Selva Negra, 1700 m, Aug- 1987, J. de la Maza E. leg.: 1 ♂ NVG- 24064 A 04 and 1 ♂ NVG- 24064 A 06 (leg DNA extraction, sequenced), NVG- 24101 A 01 (abdomen DNA extraction and dissection), genitalia NVG 241220 - 23 (Fig. 74 m – o). Type locality. Mexico: Chiapas, San Antonio, elevation 4000 ’.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B167262FE14FBB0AA43FACD.taxon	etymology	Etymology. The name is formed from the name of the Mexican state with the type locality. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B167262FE14FBB0AA43FACD.taxon	distribution	Distribution. Currently known only from Chiapas, Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B167262FE14FBB0AA43FACD.taxon	discussion	Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus draudti ”, but according to our sequencing results, this specimen is not conspecific with the intended “ holotype ” of this name. To avoid further confusion, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus draudti ” for nomenclatural purposes. Thus, we consider this name to be unpublished.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B157263FE17FAA3AA43F862.taxon	description	http: // zoobank. org / 2148 CD 01 - 73 EB- 4 D 19 - A 482 - EE 1668 D 2 F 814 (Figs. 61 part, 74 p – t, 79, 81 a – b, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B157263FE17FAA3AA43F862.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 79 (genitalia Fig. 74 p – t), bears the following eight printed (text in italics handwritten) rectangular labels (3 rd blue, the last red and others white): [COLOMBIA: Cauca; SUAREZ | AREA 1600 m. | 14 / X / 197 4 | No. C H- 145 Coll. | by S. R. y L. M. Steinhauser], [ASTRAPTES CHIRIQUENSIS | CHIRIQUENSIS STDGR. | ♂ | Det: S. R. Steinhauser], [PARATYPE ♂ | Telemachus | draudti | S. R. Steinhauser], [SRS Database | No. 670], [Genit. Prep. | SRS- 921], [A. C. Allyn | Acc. 1975 - 17], [DNA sample ID: | NVG- 23063 G 02 | c / o Nick V. Grishin], [HOLOTYPE ♂ | Telegonus (Rhabdoides) | colotrix Grishin]. Paratypes: 1 ♂ and 2 ♀♀: Colombia: 1 ♂ NVG- 24028 D 04 no locality details, old, W. Kalbreyer leg. [MFNB]; 1 ♀ NVG- 14104 A 03 (leg DNA extraction, sequenced), NVG- 23119 E 11 (abdomen DNA extraction and dissection) Valle del Cauca, 5 km N of Darién, 1500 m, 16 - Jan- 1988, J. B. Sullivan leg., genitalia NVG 240817 - 50 (Fig. 81 a, b) [USNM]; and 1 ♀ NVG- 18027 G 08, USNMENT 01465202 old, from the Neumögen collection [USNM] with a handwritten label [Telegonus | chiriquensis | Stgr. | chiriqui]. It remains unclear whether “ chiriqui ” on the label refers to the collecting locality of this specimen or the type locality of T. chiriquensis, probably the latter. Type locality. Colombia: Cauca Department, Suarez area, elevation 1600 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B157263FE17FAA3AA43F862.taxon	etymology	Etymology. The name is a fusion of Colo [mbia] + [mere] trix for this species from Colombia previously misidentified as T. meretrix. Furthermore, it is a rather colorful species. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B157263FE17FAA3AA43F862.taxon	distribution	Distribution. Currently known from Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B157263FE17FAA3AA43F862.taxon	discussion	Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus draudti ”, but according to our sequencing results, this specimen is not conspecific with the intended “ holotype ” of this name. To avoid further confusion, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus draudti ” for nomenclatural purposes. Thus, we consider this name to be unpublished.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B137265FEECFF01A801F958.taxon	description	http: // zoobank. org / 597 C 1 EFD- 5 F 59 - 494 C- 9 E 23 - 1 E 8 C 549 FB 043 (Figs. 61 part, 80, 81 c – d, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B137265FEECFF01A801F958.taxon	materials_examined	Type material. Holotype: ♀ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 80 (genitalia Fig. 81 c, d), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [Guapiles | CR | 850 ft. alt], [Collection | WmSchaus], [Telemachus latimargo ♀ | (Herrich-Schäffer, 1869) | Det. S. R. Steinhauser], [DNA sample ID: | NVG- 14105 A 05 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 E 12 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 51 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | flavimargo Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Costa Rica: Limón Province, Guapiles, elevation 850 ’.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B137265FEECFF01A801F958.taxon	etymology	Etymology. The name is given for the yellow (flavus in Latin) marginal area of the ventral hindwing. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B137265FEECFF01A801F958.taxon	distribution	Distribution. Currently known only from the holotype, female, collected in north-central Costa Rica.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B137265FEECFF01A801F958.taxon	discussion	Comment. We list data on all labels of the holotype, verbatim, including identification labels. One of such labels contains an unpublished name “ Telemachus. ” Here, we use Art. 8.3. of the ICZN Code and disclaim the name “ Telemachus ” for nomenclatural purposes. Thus, we consider this name to be unpublished.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B127267FE1FF94FAA3BFDC3.taxon	description	http: // zoobank. org / 6783 C 93 A-E 535 - 4 D 2 A-B 6 E 0 - EDAFECE 13 CDE (Figs. 61 part, 74 u – v, 82, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B127267FE1FF94FAA3BFDC3.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 82 (genitalia Fig. 74 u, v), bears the following six printed (text in italics handwritten) rectangular labels, five white: [BRAZIL: Sta Catarina | Joinville, 0 - 200 m | 26 O 19 ' S 48 O 53 ' W | 27. XI. 1988 | leg. H. Miers], [DNA sample ID: | NVG- 19071 H 11 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 F 01 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 52 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01588534], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | sobrasus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 6 ♂♂ and 2 ♀♀ from Brazil: Bahia? (unlabeled specimens, likely historical collection lot no. 4959, two specimens out of three, from either Bahia or Pará), old, Gomez leg. [MFNB]: 1 ♂ NVG- 24034 A 01 and 1 ♀ NVG- 24034 A 02; 1 ♂ NVG- 24028 D 08 Minas Gerais (no detailed locality), old, R. Haensch S. [MFNB]; Espirito Santo, Leopoldina, 1894 Michaelis leg. [MFNB]: 1 ♂ NVG- 24028 C 02 and 1 ♀ NVG- 24028 E 04; 1 ♂ NVG- 24101 B 03 Paraná, Antonina, Guaricica Ecological Reserve, 15 m, GPS − 25.3078, − 48.6950, J. A. Shuey & P. Labus leg., genitalia RAA 0761 [MGCL]; and Santa Catarina (no detailed locality) [USNM]: 1 ♂ NVG- 14111 D 03 Apr- 1945, from S. S. Nicolay collection and 1 ♂ NVG- 18027 G 07, USNMENT 01465201 from B. Neumögen collection, likely around 1900, Genit. Prep. SRS- 1049. Type locality. Brazil: Santa Catarina, Joinville, elevation ca. 50 m, GPS − 26.3167, − 48.8833.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B127267FE1FF94FAA3BFDC3.taxon	etymology	Etymology. The name is derived from the locality in So [uth] + Bras [il] + us and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B127267FE1FF94FAA3BFDC3.taxon	distribution	Distribution. Eastern and southern parts of Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B107278FEC5FDD0ADFBFD78.taxon	description	http: // zoobank. org / 54170 B 26 - F 116 - 400 F-BFED-C 8 BE 8 F 1 D 25 E 1 (Figs. 61 part, 81 e – g, 83, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B107278FEC5FDD0ADFBFD78.taxon	materials_examined	Type material. Holotype: ♀ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 83 (genitalia Fig. 81 e – g), bears the following five rectangular labels (1 st handprinted, others printed), four white: [ECUADOR - ESM | CHUCHUVI 800 m | VI- 2018], [Mark Simon Colln | MGCL Accession | # 2021 - 10], [DNA sample ID: | NVG- 24086 F 12 | c / o Nick V. Grishin], [genitalia: | NVG 241220 - 28 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Telegonus (Rhabdoides) | chuchuvianus Grishin]. Type locality. Ecuador: Esmeraldas, Chuchuví, elevation 800 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B107278FEC5FDD0ADFBFD78.taxon	etymology	Etymology. The name is derived from the type locality and is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B107278FEC5FDD0ADFBFD78.taxon	distribution	Distribution. Currently known only from the holotype collected in northern Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0F727AFE1AFD78AA59FCE8.taxon	description	http: // zoobank. org / 84351388 - A 1 AB- 48 A 1 - 82 ED- 169 F 7 C 16 CD 10 (Figs. 61 part, 84, 85 a – g, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0F727AFE1AFD78AA59FCE8.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 84 (genitalia Fig. 85 a, b), bears the following five printed (text in italics handprinted) rectangular labels, four white: [PANAMA CANAL ZONE: | Barro Colorado Is. | 27 JULY 1977. | Silberglied / Aiello | AT LIGHTS], [DNA sample ID: | NVG- 14111 C 10 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 F 02 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 53 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | panamus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1 ♂ NVG- 23063 F 12 Panama, Panamá Province, Summit, 2 - Sep- 1977, R. Hesterberg leg., genitalia vial SRS- 1051 (Fig. 85 c – g) [MGCL]. Type locality. Panama: Panamá Oeste Province, Barro Colorado Island.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0F727AFE1AFD78AA59FCE8.taxon	etymology	Etymology. The name is derived from the name of the country with the type locality and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0F727AFE1AFD78AA59FCE8.taxon	distribution	Distribution. Currently known only from central Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0D727BFE3DFCE4AD9CFB8B.taxon	description	http: // zoobank. org / 2 E 3436 DE- 28 EB- 400 F- 9794 - 3865 EF 77 ADFE (Figs. 61 part, 85 h – i, 86, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0D727BFE3DFCE4AD9CFB8B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 86 (genitalia Fig. 85 h, i), bears the following five printed (text in italics handwritten) rectangular labels, four white: [PANAMA: PANAMA | 5 mi N El Llano | 330 m 9 o 17 ' N 79 o 00 ' W | 14 Jun 1978 | leg. G. B. Small], [DNA sample ID: | NVG- 14111 D 05 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 F 03 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 54 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | tatus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Panama: Panamá Province, 5 mi north of El Llano, elevation 330 m, approx. GPS 9.283, − 79.000.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0D727BFE3DFCE4AD9CFB8B.taxon	etymology	Etymology. The name is formed from its sister species’ name, cretatus, made shorter for this more northern relative, and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0D727BFE3DFCE4AD9CFB8B.taxon	distribution	Distribution. Currently known only from the holotype collected in central Panama.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0C727DFEEDFB16A9C7FDB6.taxon	description	http: // zoobank. org / BA 7 F 1423 - 91 F 4 - 47 A 9 - 930 F-F 756 AC 10391 C (Figs. 61 part, 85 j – n, 87 a, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0C727DFEEDFB16A9C7FDB6.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 87 a (genitalia Fig. 85 j, k), bears the following six printed (text in italics handwritten) rectangular labels, five white: [PERU: Cuzco 1194 m | Quebrada Santa Isabel | Cosñipata Valley 5162 | 22 - X- 2016 Kinyon], [DNA sample ID: | NVG- 19075 A 12 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23119 F 04 | c / o Nick V. Grishin], [genitalia: | NVG 240817 - 55 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01588547], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | fulvimargo Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 4 ♂♂ from Peru: Cuzco: 1 ♂ NVG- 14104 B 02 Cosñipata Road, Quebrada Quitacalzón, elevation 1050 m, 27 - Jan- 2013, S. Kinyon leg. [USNM] and 1 ♂ NVG- 24019 E 10 Marcapata, old, A. Seitz collection [SMF] and 1 ♂ NVG- 18027 G 03, USNMENT 01465197 no detailed locality or date, old, donated by B. P. Clark, genitalia vial SRS- 1837 [USNM] and 1 ♂ NVG- 24064 B 08 Bolivia, La Paz Department, Sud Yungas Province, Rio Selva Resort, 2500 ’, GPS − 16.203944, − 67.794139, 8 - Mar- 2000, T. Emmel & S. Schlachta leg., an unnumbered vial with genitalia likely dissected by D. L. Lindsley is pinned between the labels (Fig. 85 l – n) [MGCL]. Type locality. Peru: Cuzco, Cosñipata Valley, Quebrada Santa Isabel, elevation 1194 m, approx. GPS − 13.0333, − 71.5167.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0C727DFEEDFB16A9C7FDB6.taxon	etymology	Etymology. The name is given for the fulvous (rather than “ flavous ”) ventral hindwing marginal area and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0C727DFEEDFB16A9C7FDB6.taxon	distribution	Distribution. Currently known only from the eastern slopes of the Andes in southern Peru and eastern Bolivia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0A727EFF78FAFBAA45FF37.taxon	discussion	Genomic analysis of the lectotype of Telegonus fabrici Ehrmann, 1918 (type locality Venezuela: Caura Valley, sequenced as NVG- 15096 C 02) currently treated as a junior subjective synonym of Telegonus alardus alardus (Stoll, 1790) (type locality in Suriname) is not monophyletic with it and is placed among specimens of Telegonus latimargo (Herrich-Schäffer, 1869) (type locality in tropical America to USA, sequenced as NVG- 15031 C 08) (Fig. 61). Therefore, we propose that Telegonus fabrici Ehrmann, 1918 is a junior subjective synonym of Telegonus latimargo (Herrich-Schäffer, 1869), rather than of T. alardus alardus, resulting in a new synonym placement. Moreover, while specimens from western Colombia that we identified as Astraptes alardus aquila Evans, 1952 (type locality in Colombia: Cauca Valley), due to their reduced white overscaling towards the ventral hindwing margin, differ from both T. latimargo and T. alardus by this character of their wing pattern, they are genetically placed among specimens of T. latimargo (Fig. 61). Because subspecies are frequently defined only by their wing patterns, they do not have to be separated into clades by their overall genetic similarity. Hence, not willing to synonymize the name, we propose to treat A. alardus aquila Evans, 1952 as a subspecies of T. latimargo forming a new species-subspecies combination: Telegonus latimargo aquila (Evans, 1952), comb. nov. Finally, both species, T. latimargo and T. alardus, are present in the Department of Tolima, Colombia (Fig. 61), although they have not been recorded at the same locality.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B0A727DFE14FD24A8B8FAFC.taxon	discussion	Genomic analysis of the lectotypes of Eudamus latimargo Herrich-Schäffer, 1869 (type locality in tropical America to USA, sequenced as NVG- 15031 C 08) and Thymele grullus Mabille, 1888 (type locality in Panama: Chiriquí, sequenced as NVG- 15031 B 12) reveals that they belong to two distinct and not even most closely related species in different clades of the genomic trees (Fig. 61), and their COI barcodes differ by 3 % (20 bp). Therefore, we propose that Telegonus grullus (Mabille, 1888), stat. rest. is a species distinct from Telegonus latimargo (Herrich-Schäffer, 1869). The latter species is closely related to Telegonus alardus (Stoll, 1790) (type locality in Surinam). Evans (1952) swapped the identities of these two species, treating T. grullus as a synonym of T. alardus, and we identify Evans’s T. latimargo as T. grullus. Godman and Salvin (1893 - 1899), who inspected the lectotype of T. grullus, identified this species correctly. Telegonus grullus has more prominent dark spots (partly connected into bands) on the ventral forewing, darker than pure white hindwing fringes in males, and the anal fold of the hindwing is brown beneath, but the fringe near the tornus may be paler. In contrast, ventral forewing spots are “ washed out ” in T. latimargo, especially towards tornus, hindwing fringes are mostly white, and the distal part of the anal fold is white beneath. Both characters are observed in the lectotypes of these two species (Warren et al. 2024).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B09727FFE19FEBCAD54FD2D.taxon	description	http: // zoobank. org / 427 C 08 A 0 - E 75 F- 4662 - B 454 - 1609 D 10 ECC 97 (Figs. 61 part, 85 o – x, 88, 89 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B09727FFE19FEBCAD54FD2D.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 88 (genitalia Fig. 85 o – s), bears the following five printed (text in italics handwritten) rectangular labels, four white: [BRASIL: R. de JANEIRO | Petropolis, 1500 m. | 1. V. 197 1 | C. Callaghan], [Genit. Prep. | SRS- 831], [A. C. Allyn | Acc. 1974 - 3], [DNA sample ID: | NVG- 23063 G 09 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Telegonus (Rhabdoides) | alardinus Grishin]. Paratypes: 2 ♂♂ and 4 ♀♀ from Brazil: Rio de Janeiro: 1 ♂ NVG- 24064 B 03 Magé municipality, Suruí district, km 14 of Rio – Teresópolis Highway (BR- 116), 5 - Jul- 1971, C. Callaghan leg., genitalia NVG 241111 - 02 (Fig. 85 v – x) [MGCL], 1 ♀ NVG- 19075 D 01, USNMENT 01588571 Teresópolis, Barragem Parque Nacional da Serra dos Orgãos, elevation 1100 m, approx. GPS − 22.45, − 43.00, 16 - Feb- 1995, Astrid Caldas and students leg. [USNM], and 1 ♀ NVG- 24019 B 02 (no other data) old [SMF] and Santa Catarina: 1 ♂ NVG- 19075 C 11 (leg DNA extraction, sequenced), NVG- 23119 F 05 (abdomen DNA extraction and dissection), USNMENT 01588569, Joinville, Vila Nova, elevation 200 m, approx. GPS − 26.367, − 48.933, 23 - Mar- 1991, Robert K. Robbins & Olaf H. H. Mielke leg., genitalia NVG 240817 - 56 (Fig. 85 t, u) [USNM] and 1 ♀ NVG- 24064 B 04 São Bento do Sul, Feb- 1984, Rank leg. [MGCL] and 1 ♀ NVG- 24028 C 09 Paraguay, old, P. Gladhorn S. K. [MFNB]. Type locality. Brazil: Rio de Janeiro, Petropolis, elevation 1500 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B09727FFE19FEBCAD54FD2D.taxon	etymology	Etymology. The name is formed from its sister species T. alardus and made longer to indicate a more southern distribution of this species. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B09727FFE19FEBCAD54FD2D.taxon	distribution	Distribution. Southeast and South Brazil and Paraguay.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B09727FFE19FEBCAD54FD2D.taxon	discussion	Comment. Genitalia of the holotype, vial SRS- 831, prepared by S. R. Steinhauser, became nearly transparent, likely due to overexposure in KOH, and were stained for photography with Double Stain containing lignin pink, acid fuchsin, GAA, lactic acid, and phenol (Fig. 85 o – s).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B087272FE98FC8BADB6FC83.taxon	discussion	Phylogenetic trees constructed from protein-coding regions in genomic sequences reveal that the species of the subgenus Rhabdoides Scudder, 1889 (type species Eudamus cellus Boisduval & Le Conte, [1837]) in the genus Telegonus Hübner, [1819] (type species Papilio talus Cramer, 1777) from the clade (Li et al. 2019) that we analyzed in this study partition into six major subclades that we define as species groups (Fig. 89). These are all Rhabdoides, excluding the clades with Telegonus anaphus (Cramer, 1777) and Telegonus cellus (Boisduval & Le Conte, [1837]): Rhabdoides species not shown in the list below belong to the outgroup and should be placed after the last entry given in this list. We use the name of the species with the oldest valid name in each group as the group name. Although the attribution of species to these groups is the same according to the trees constructed from autosomes and the Z chromosome, the topology between and within the groups differs somewhat (compare Fig. 89 a and b). Each topology is supported by confident statistics (Fig. 89), suggesting complexities in the early evolution of these species, such as incomplete lineage sorting or gene exchange. These complexities are further corroborated by the mitochondrial genome tree, which reveals a third topology differing from the nuclear tree in the placement of many species and species groups (Fig. 89). In the list below, we attempt to order species to maximize the phenotypic similarity and geographic proximity of the list neighbors but without disrupting phylogenetic orders given in both genomic trees (Fig. 89): i. e., a strongly supported clade in the trees is a continuous segment in the list. We were guided by the following considerations. We start by ordering species groups. First, Telegonus parmenides (Stoll, 1781), stat. rest. was historically regarded as a junior subjective synonym of Telegonus creteus (Cramer, 1780) due to phenotypic similarity and its type locality (Suriname). However, assuming that our identification of these species is correct (see above, we follow Steinhauser’s identification before designation of neotypes), these two species belong to two different species groups. Therefore, we place the creteus and parmenides species groups next to each other in the list. Second, this adjacent position of these two groups necessitates that the elorus group is the neighbor of the creteus group (on the other side from the parmenides group) and the alector species group is the neighbor of the elorus group (according to both trees, not to disrupt their phylogenetic order); while the latimargo group is the neighbor of the parmenides group (on the other side from the creteus group) and the galesus group is the neighbor of the parmenides group (according to the Z chromosome tree). These two considerations fix the order of the species groups as: alector, elorus, creteus, parmenides, latimargo, and galesus, or a reverse of this order. Third, we choose to start the list from the alector group because of the phenotypic similarity between Telegonus alector (C. Felder & R. Felder, 1867) and the Telegonus fulgerator (Walch, 1775) group (basal area of ventral hindwing by the costa is white and forewings are with a central pale band at least in some species), the latter being placed in the list before the species analyzed in this work. We use similar considerations to order species within each species group. When the order is inconsistent between the autosome and the Z chromosome trees, we select the Z chromosome order. Phylogenetic trees constructed from genes encoded in the Z chromosome typically correlate better with species trees due to less introgression and gene exchange involving the Z chromosome. One challenge that we met was the presence of both yellow-margined (e. g., T. chiriquensis vs. T. fulvimargo sp. n.: both species have extensive yellow scaling in the submarginal area of the ventral hindwing, giving an appearance of a marginal yellow band) and brown-margined (e. g., T. creteus vs. T. parmenides: both species possess mostly brown margins) species in the creteus and parmenides groups. Because it is not possible to satisfy placing both wing pattern categories next to each other in the list without violating phylogenetic constraints, only one of them must be chosen. We chose to place brown-margined species (T. creteus and T. parmenides with their closest relatives) adjacent in the list, thus placing the creteus and the parmenides groups near each other due to the similarity between them and the resulting confusion in the literature about these species. Consequently, the yellow-margined species ended up on opposite sides of their corresponding groups. Compensating for this by adjusting the order of species in other groups, we made these yellow-margined species adjacent to pale- or yellow-margined species in species groups that are closest to them in the list (the elorus group is adjacent to the creteus group, and the latimargo group is next to the parmenides group). We note that any phylogenetic arrangement precludes placing all pale-margined species together in the list, because they are distributed among four species groups, three of which include brown-margined species. Moreover, one species (T. weymeri) is variable in the expression of yellow submarginal overscaling, and its sister species (T. perumazon sp. n.) is brown-margined. Further refinements of the list order are encouraged. In the resulting arrangement below, species of Rhabdoides excluding the clades with Telegonus anaphus (Cramer, 1777) and Telegonus cellus (Boisduval & Le Conte, [1837] are given. The list also includes species discovered by Steinhauser (1987) (“ four new species will be added to the group ”) that fall within these species groups but remain unpublished, shown in gray font. Type localities (general area only: state, region, department, or county) are in gray font. New taxa described in this study and the category of taxonomic change are in red font. Taxonomic treatment before this work (for valid names) or the category of synonym (for synonyms) and comments are shown in smaller font following a vertical bar | after the type locality; an equal sign = precedes synonyms given in their original genus combination; and a double dagger ‡ marks unavailable names. The list covers 50 valid taxa comprising 44 species (18 newly proposed here and 4 yet undescribed) and 6 additional subspecies (1 new): i. e., 27 previously known and 23 undescribed before this work. Our study follows the trend to reveal approximately as many new Hesperiidae taxa as previously described ones in nearly every genus under revision (Austin and Mielke 1998; Austin and Mielke 2008; Medeiros et al. 2019; Siewert et al. 2020).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF7FFB89AD9AFBFC.taxon	distribution	Colombia: Bogota	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF7FFBD6AD77FB9B.taxon	distribution	Ecuador: Esmeraldas	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FFAD5AABAFA98.taxon	distribution	Brazil: Rondônia	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FFAF1AA8EFA44.taxon	distribution	likely Brazil	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF7FFA1EAD10FA63.taxon	distribution	likely Brazil	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF7FFA3BACB0FA0F.taxon	distribution	Brazil [likely S] | was a subspecies of creteus	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FF99CADF1F98C.taxon	distribution	Guatemala: San Gerónimo | was a subspecies of creteus	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF7FF971ADFDF8C4.taxon	distribution	Ecuador: Zamora	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF7FF89EAD68F8E3.taxon	distribution	Bolivia: Yungas & La Paz	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FF955AD09F919.taxon	discussion	| was a subspecies of creteus	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FF8BBADD2F87C.taxon	distribution	likely SE or S Brazil]	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FFB46ACBAFB28.taxon	distribution	Mexico: San Luis Potosí | was a synonym of hopfferi	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FFBF2AA4DFB60.taxon	distribution	Mexico [likely C or S Mexico] | was a subspecies of alector	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FFB39AACFFB0C.taxon	distribution	USA: Texas, Hidalgo Co.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FFA8FAA35FAF2.taxon	distribution	Peru: Piura	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FF9C6AA64F9AB.taxon	distribution	Panama: Darién	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FFB63AAA8FAD6.taxon	distribution	Panama: Panamá	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B057272FF2FF90FAA9CF972.taxon	distribution	Brazil: Santa Catarina	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FF980AA84F9F5.taxon	distribution	Brazil: Rio de Janeiro	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF7FFA7BAA59F9CE.taxon	distribution	Suriname	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF7FFA5EAA45FA23.taxon	distribution	Costa Rica	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFEEEAA73FE53.taxon	distribution	Mexico: Chiapas	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFE0BAD63FE1A.taxon	distribution	Panama: Chiriquí	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFE0BAD63FE1A.taxon	discussion	| junior subjective synonym	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFCD7AACBFC9A.taxon	distribution	Ecuador: Esmeraldas	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFE7CAA77FDC1.taxon	distribution	Colombia: Cauca	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF7FFBDCAD39FBA1.taxon	distribution	Brazil: Espirito Santo	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF7FFC6FADF0FBF9.taxon	distribution	Ecuador: Napo	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFD51ABD5FD24.taxon	distribution	Suriname	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFFFCAD0EFF41.taxon	distribution	unknown, likely SE or S Brazil	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFD99AC5CFDED.taxon	distribution	Ecuador: Balzapamba	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFD99AC5CFDED.taxon	discussion	| was a subspecies of chiriquensis	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFDEFAAB0FD52.taxon	distribution	Costa Rica: Limón	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFB05AA62FB68.taxon	distribution	Peru: Cuzco	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FF8D9AA52F8AC.taxon	distribution	Peru: Chanchamayo	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFF56AC17FF18.taxon	distribution	Panama: Chiriquí | was a synonym of latimargo	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FF9ADAB93F990.taxon	distribution	Cuba	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FF9C9ACA9F906.taxon	distribution	Brazil " [Dominican Republic]	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF7FFA84AC9AFAEE.taxon	distribution	Colombia: Valle	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF7FFA84AC9AFAEE.taxon	discussion	| was a subspecies of alardus	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF7FFAA0ACFDFA5F.taxon	distribution	Tropical America to USA	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFBF9AC33FB4D.taxon	distribution	Ecuador	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFBF9AC33FB4D.taxon	discussion	| was a subspecies of chiriquensis	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFC19AD0FFC6C.taxon	distribution	Panama: Barro Colorado Island	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFCFCAC35FC41.taxon	distribution	likely Suriname	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFCFCAC35FC41.taxon	discussion	| was a synonym of creteus	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFE9FAA9FFEE2.taxon	distribution	Peru: Madre de Dios	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFD7EAA8CFCC3.taxon	distribution	Brazil: Santa Catarina	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFEA4AC91FEB5.taxon	distribution	Mexico: Veracruz	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FF895ACB0F887.taxon	distribution	Ecuador: Chimborazo	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFC26AA19FC0B.taxon	distribution	Panama: Panamá	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFD34AC91FD7E.taxon	distribution	Brazil: Pará |	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047273FF2FFD34AC91FD7E.taxon	discussion	Evans (1952) treated it as a subspecies of latimargo	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B047274FF2FF8E6ADF6FEDD.taxon	distribution	Costa Rica: Irazú	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B037274FE84FE22AD98FCFE.taxon	discussion	Genomic sequencing of the holotype of Arteurotia meno Mabille, 1889 (type locality in Panama, sequenced as NVG- 15032 E 05), currently a subspecies of Pellicia (Pellicia) dimidiata Herrich-Schäffer, 1870 (type locality in Mexico and La Guaira, [Venezuela], a syntype from Venezuela sequenced as NVG- 15032 E 10), reveals that it is not monophyletic with it and instead belongs to the subgenus Hemipteris Mabille, 1889 (type species Hemipteris fumida Mabille, 1889, currently treated as a junior subjective synonym of Pellicia tyana Plötz, 1882, but see below) (Fig. 90). Because A. meno is not conspecific with any older name in this subgenus, we propose that Pellicia (Hemipteris) meno (Mabille, 1889), stat. rest. is a valid species distinct from Pellicia (Pellicia) dimidiata Herrich-Schäffer, 1870.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B037274FEDDFCFAA8FFFB3C.taxon	discussion	Genomic analysis of the holotype of Pellicia brasiliensis R. Williams & E. Bell, 1939 (type locality in Brazil: Minas Gerais, sequenced as NVG- 15097 B 10), currently a junior subjective synonym of Pellicia (Hemipteris) meno (Mabille, 1889), stat. rest. (type locality in Panama, holotype sequenced as NVG- 15032 E 05) reveals that it is not monophyletic with it, but instead groups closely with Pellicia (Pellicia) dimidiata Herrich-Schäffer, 1870 (type locality in Mexico and La Guaira, [Venezuela]) (Fig. 90). The current synonymy follows Evans (1953), who likely misidentified P. meno and mistook P. brasiliensis for it. Therefore, we propose that Pellicia (Pellicia) dimidiata brasiliensis R. Williams & E. Bell, 1939, stat. nov. is a valid subspecies.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4B017289FF13F974ABF2F86C.taxon	discussion	Genomic analysis of primary type specimens of Pellicia Herrich-Schäffer, 1870 (type species Pellicia dimidiata Herrich-Schäffer, 1870) reveals many inconsistencies with the current classification (Mielke 2005). Here, we stabilize nomenclature with lectotype designations. We encountered two problems with the syntypes of the four taxa discussed here. First, we found two credible syntypes of Pellicia tyana Plötz, 1882 (type locality in South America), and the syntype in MFNB (NVG- 15032 D 11, Figs. 90, 91 g) is not conspecific with the syntype in ZSMC (NVG- 18056 G 09, Figs. 90, 91 e, f). Both syntypes bear identification labels written by Plötz. Additionally, the ZSMC syntype bears a red label with the first line “ Lectotypus ” but the designation remains unpublished. However, the MFNB syntype (sequenced as NVG- 15032 D 11) agrees better with the original description and Godman’s (1907) copies (in BMNH and USNM) of unpublished Plötz’s drawing t [afel]. 202 of P. tyana (Fig. 91 h): it has more uniform violaceous overscaling towards the tornus of the ventral hindwing (as the drawing and description: “ underside … hindwing lilac-gray in the posterior half ” (Plötz 1882 b )) vs. violaceous overscaling in the ZSMC syntype having an appearance of two crossbands in the posterior part of the wing (discal and postdiscal) plus violaceous overscaling along the outer margin. Moreover, the MFNB syntype is indeed from South America, as deduced from genomic sequencing, but the ZSMC syntype is likely to be from Panama, although it bears a label “ S America ”. A similar locality label is on a ZSMC syntype of Staphylus vincula (Plötz, 1886) (type locality in Panama), which was also not from South America, based on genomic comparison (Zhang et al. 2022 d). Therefore, we conclude that the syntype in MFNB represents Plötz’s concept of P. tyana better than the ZSMC syntype. To stabilize nomenclature and define the name P. tyana objectively, N. V. G. hereby designates a syntype in the MFNB collection that is shown in Fig. 91 g and bears the following ten labels (1 st red, others white; 3 rd to 8 th handwritten, others printed): [typus], [Coll. Weymer], [Tyana Pltz | taf 202.], [Pellicia (156 c) | Plana Pl.], [H S | 72 | Weymer], [54 | Weymer], [26: 15.], [Tyana Plötz i l. | Plana Plötz il. | (olim) | Amer. mer.], [{QR Code} http: // coll. mfn-berlin. de / u / | 940 b 8 d], [DNA sample ID: | NVG- 15032 D 11 | c / o Nick V. Grishin] as the lectotype of Pellicia tyana Plötz, 1882. Handwriting on the 3 rd and 8 th labels matches that of Weymer, and on the 4 th that of Plötz, and taf [el] 202 is the number of the unpublished Plötz’s drawing of P. tyana mentioned in the original description (Plötz 1882 b). Therefore, this specimen might have been the model for the drawing. The label [26: 15.] corresponds to the number for P. tyana in Mabille’s catalog, where the locality for this species is given as “ Sao-Paulo ” [Brazil] (Mabille 1903), the same locality is listed on the unpublished Plötz’s drawing, according to Godman (1907). Therefore, we infer that the type locality of P. tyana is in Brazil: São Paulo. The lectotype is missing its abdomen and both antennae. Images of this specimen (Fig. 91 g) photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15032 D 11, GenBank PV 550034, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCCGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT Second, we found only one syntype for each of the remaining three taxa discussed here. For two of them, Godman’s (1907) copies (in BMNH and USNM) of Plötz’s unpublished drawing agree well with the original description and syntype specimens. However, the drawing of Arteurotia demetrius Plötz, 1882 (type locality in Brazil) (Fig. 91 j) does not, and is so unusual that neither Godman (1907) nor Evans (1953) was able to associate a specimen with the drawing. The original description refers to specimens with the number 5912 in Berlin. Only one specimen (Fig. 91 i) was listed for No. 5912 in the catalog of the MFNB historical collections. This specimen agrees with the original description translated here as: “ No hyaline spots. Brown, forewing above with 2 darker, slightly curved crossbands, beneath at the costal margin passed the middle with 3 gray spots. Hindwing beneath predominantly gray, the costal margin [area] and 3 fading bands are brown ” (Plötz 1882 b). Conversely, the drawing shows 3 gray bands rather than spots (as in the specimen) on the ventral forewing, and brown with grayish cross-rays on the ventral hindwing, quite different from the specimen and the description. Nevertheless, out of syntypes of all these names we were able to find, the drawing of A. demetrius is most similar to the specimen No. 5912, because this specimen has the most extensive violaceous gray overscaling on ventral hindwing (Fig. 91 i). Overall, we have no reason to doubt the status of the specimen No. 5912 as a syntype and hypothesize that Godman’s copy of Plötz’s drawing t [afel]. 205 is inaccurate (Fig. 91 i vs. j). We doubt that the original drawing was any more accurate because the illustration of A. demetrius in Draudt (1921 – 1924), which is likely to be an independent copy of the original Plötz’s drawing, is more similar to Godman’s copy than to the syntype. To stabilize nomenclature and define the name A. demetrius objectively, N. V. G. hereby designates a syntype in the MFNB collection that is shown in Fig. 91 i and bears the following eight labels (1 st red, 4 th green, others white; 3 rd, 4 th and 5 th handwritten, others printed with handwritten text shown in italics): [Type], [5912], [demetrius | Pl. | type], [Brasil. Bescke], [Gen. prep. | Mielke 1979], [Genital-Unters. | Nr. 4712 | Zool. Mus. Berlin], [{QR Code} http: // coll. mfn-berlin. de / u / | 940 ba 2], [DNA sample ID: | NVG- 15032 E 12 | c / o Nick V. Grishin] as the lectotype of Arteurotia demetrius Plötz, 1882. The number 5912 on the 2 nd label refers to a specimen lot documented in the catalog of historical collections. Under the entry 5912, the catalog lists a single specimen of an undetermined species collected in Brazil by Bescke. We guess that it was probably collected near Rio de Janeiro, because Bescke collected there. This general locality is also consistent with the results of genomic sequencing, placing the lectotype among specimens from that region. The lectotype has a nick in the middle of the outer margin of the right hindwing and some damage at the outer margin of the left forewing near the tornus. Images of this specimen (Fig. 91 i) photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15032 E 12, GenBank PV 550035, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCAGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTACTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT Next, lectotypes of the remaining two taxa are designated. To stabilize nomenclature and define the name Pellicia violacea Mabille, 1891 (type locality in Brazil) objectively, N. V. G. hereby designates a syntype in the MFNB collection that bears the following ten labels (1 st and 3 rd shades of purple, others white; 3 rd, 4 th, 5 th, and 7 th handwritten, others printed with handwritten text shown in italics): [Origin.], [Coll. H. — Sch | Brasilien], [arteu. violacea | ♂ type Mab.], [ab Meno | Mab.? | (ich habe Origin.) | (Mab.)], [Rubescens | Plötz | violacea | Mab.], [Coll. | Staudinger], [Gen. prep. | Mielke 1979], [Genital-Unters. | Nr. 4711 | Zool. Mus. Berlin], [{QR Code} http: // coll. mfn-berlin. de / u / | 44 a 098], [DNA sample ID: | NVG- 15034 E 05 | c / o Nick V. Grishin] as the lectotype of Pellicia violacea Mabille, 1891. The 3 rd and the 4 th labels are in Mabille’s and Staudinger’s handwriting, respectively. The lectotype is missing its right hindwing, which is placed in a small triangular envelope pinned with the labels. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). Genomic comparison suggests that the type locality of P. violacea is likely in Rio de Janeiro, Brazil. The COI barcode sequence of the lectotype, sample NVG- 15034 E 05, GenBank PV 550036, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCCGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT To stabilize nomenclature and define the name Pellicia vecina Schaus, 1902 (type locality Brazil: Rio de Janeiro, Petropolis) objectively, N. V. G. hereby designates a syntype in the USNM collection that bears the following six labels (4 th red, others white; 3 rd handwritten, others printed with handwritten text shown in italics): [Petropolis, | Brazil.], [Collection | W. Schaus], [Pellicia | vecina | type Schs], [Type | No. 5977 | U. S. N. M.], [GENITALIA NO. | 1394 | J. M. Burns 1976], [USNMENT | {QR Code} 00913108] as the lectotype of Pellicia vecina Schaus, 1902. The lectotype is missing a section of the right hindwing at the tornus and a smaller segment on the left hindwing at the outer margin near the tornus. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 18061 C 10, GenBank PV 550037, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCTTTAAGTTTACTTATTCGATCCGAATTAGGAGCCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCCTTAACTTTATTAATTTCAAGAAGTATCGTAGAAAATGGTGCAGGAACAGGTTGAACTGTATACCCCCCTTTATCAGCTAATATTGC CCATCAAGGTTCTTCCGTTGATTTAGCAATTTTTTCCTTACATTTAGCAGGTATCTCATCTATTTTAGGAGCTATTAATTTTATTACAACTATTATCAATATACGAATTAATAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTACTATTATCTTTACCAGTTCTAGCAGGAGCTATTACTATATTACTAACTGATCGTAATTTAAATACTT CCTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFD728AFE8BFF14ACF9FD7A.taxon	discussion	Genomic analysis reveals that in addition to Pellicia violacea Mabille, 1891 (type locality in Brazil, lectotype sequenced as NVG- 15034 E 05), which is currently treated as a junior subjective synonym of Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in South America, probably in Brazil: São Paulo, lectotype sequenced as NVG- 15032 D 11), lectotypes of Arteurotia demetrius Plötz, 1882 (type locality in Brazil, probably Rio de Janeiro, NVG- 15032 E 12) and Pellicia vecina Schaus, 1902 (type locality Brazil: Rio de Janeiro, Petropolis, NVG- 18061 C 10) cluster closely with the lectotype of Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in South America, NVG- 15032 D 11) and another specimen from Paraguay identified as P. vecina (NVG- 18061 E 08) (Fig. 90). All these lectotypes were likely collected in Southeast Brazil. Therefore, we propose that Arteurotia demetrius Plötz, 1882, syn. nov. and Pellicia vecina Schaus, 1902 syn. nov. are junior subjective synonyms of Pellicia (Hemipteris) tyana Plötz, 1882. This is the species that Evans (1953) called P. vecina because he misidentified P. tyana and could not identify A. demetrius, but described an (inaccurate) drawing of it copied from Plötz’s original drawing t. 205 (Godman 1907) and reproduced here as Fig. 91 j. It is unknown if the original drawing was more accurate.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFD728AFE7DFD6DAABDF90F.taxon	discussion	We conclude that the specimen in the MFNB collection that bears the following seven labels (1 st purple, others white; 2 nd to 3 rd handwritten, others printed with handwritten text shown in italics): [Origin.], [Itaituba | 86 Hhn.], [hemipteris | fumida Mab. | ♂], [Fumida | Mab.], [GEN. PREP., | MIELKE 1996], [{QR Code} http: // coll. mfn-berlin. de / u / | 940 ba 3], [DNA sample ID: | NVG- 15032 F 01 | c / o Nick V. Grishin] is the holotype of Hemipteris fumida Mabille, 1889. It agrees with the original description, and according to its label, the holotype was collected in Brazil: Pará, Itaituba by Hahnel in 1886. The 3 rd label is in Mabille’s handwriting. The holotype is an aberrant specimen with hindwings not fully expanded and a poorly developed pattern of spots and bands on the dorsal side of wings, with darker scaling along the veins standing out. Images of the holotype photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the holotype, sample NVG- 15032 F 01, GenBank PV 550038, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACATCCTTAAGTTTACTTATTCGATCTGAATTAGGTACTCCTGGTTCTTTAATTGGAGATGATCAAATTTATAACACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGTGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACTGGTTGAACTGTTTATCCTCCTTTATCAGCTAATATTGC CCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCATTACATTTAGCAGGTATTTCCTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATCAATATACGAGTTAATAATTTATTA TTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGAATTACAGCTTTACTTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGTAATTTAAATACAT CTTTTTTCGACCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTC Genomic analysis of the holotypes of Hemipteris fumida Mabille, 1889 (type locality in Brazil: Pará, Itaituba, sequenced as NVG- 15032 F 01) (Fig. 90 orange) and Pellicia aequatoria Williams & Bell, 1939 (type locality in Ecuador, sequenced as NVG- 18024 D 05) (Fig. 90 pink) currently treated as a junior subjective synonyms of Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in South America, lectotype sequenced as NVG- 15032 D 11) reveals that all three taxa belong to different clades and the former two are not closely associated with any other species. Therefore, we propose that Pellicia (Hemipteris) fumida Mabille, 1889, stat. rest. and Pellicia (Hemipteris) aequatoria Williams & Bell, 1939, stat. rest. are valid species distinct from Pellicia (Hemipteris) tyana Plötz, 1882.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFD728BFEF4F890ADD6FEF8.taxon	discussion	Genomic analysis reveals that a specimen from Panama identified by Bell through genitalia inspection (slide G 1366) as Pellicia tyana toza Evans, 1953 (type locality in Colombia, Magdalena Valley), sequenced as NVG- 18019 H 06, and two other Panamanian specimens (not shown) are not monophyletic with Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in Brazil, likely São Paulo, lectotype sequenced as NVG- 15032 D 11), which Evans (1953) misidentified, and instead are closely related to Pellicia (Hemipteris) arina Evans, 1953 (type locality in Mexico: Veracruz, Atoyac) being genetically differentiated from it at the species level (Fig. 90). Therefore, we propose that Pellicia (Hemipteris) toza Evans, 1953, stat. nov. is a species distinct from Pellicia (Hemipteris) tyana Plötz, 1882.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFC728BFEA4FEE9A8BFFCEF.taxon	discussion	Originally described and currently treated as a subspecies of Pellicia vecina Schaus, 1902 (type locality Brazil: Rio de Janeiro, Petropolis, lectotype sequenced as NVG- 18061 C 10), which (see above) is a junior subjective synonym of Pellicia (Hemipteris) tyana Plötz, 1882 (type locality in Brazil, likely São Paulo, lectotype sequenced as NVG- 15032 D 11), Pellicia vecina naja Steinhauser, 1989 (type locality in Peru: Madre de Dios, holotype sequenced as NVG- 15038 E 08) is genetically differentiated from P. tyana — which is a species previously referred to as P. vecina — at the species level (Fig. 90); e. g., their COI barcodes differ by 2 % (13 bp). Therefore, given that we could not associate any older name with it, we propose that Pellicia (Hemipteris) naja Steinhauser, 1989, stat. nov. is a species distinct from Pellicia vecina Schaus, 1902.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFC728DFE5AFCFEAAA3FEB3.taxon	description	http: // zoobank. org / B 301 C 9 F 0 - F 5 CA- 4 B 5 D- 9339 - 6064 F 08 E 7 E 66 (Figs. 90 part, 92 – 93)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFC728DFE5AFCFEAAA3FEB3.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 92 (genitalia Fig. 93), bears the following six printed (text in italics handwritten) rectangular labels (4 th brownish yellow and the last red): [BRASIL: Rondônia | 62 km S Ariquemes | linea C- 20, 7 km E | B- 65, Fazenda | Rancho Grande | 14 November 1990 | leg. D & J Lindsley], [Genetalic Vial | GTA- 875], [Pellicia vecina | cyanea Biezanko & | Mielke | det. GT Austin 199 1], [photographed | G. T. Austin & J. P. Brock | March 1992], [DNA sample ID: | NVG- 23053 D 08 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Pellicia (Hemipteris) | cina Grishin]. Paratype: 1 ♂ NVG- 24083 A 08 the same data as the holotype but 7 - Nov- 1991, G. T. Austin leg., genitalia vial GTA- 2138. Type locality. Brazil: Rondônia, 62 km south of Ariquemes, linha C- 20, 7 km east of B- 65, Fazenda Rancho Grande.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFC728DFE5AFCFEAAA3FEB3.taxon	etymology	Etymology. The name is formed from the name of a related taxon, vecina, made shorter for its more northern relative. The name is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFC728DFE5AFCFEAAA3FEB3.taxon	distribution	Distribution. Currently known only from Rondônia, Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BFA728EFEFCFE27A83AFB97.taxon	discussion	Genomic analysis of many primary type specimens in the genus Pellicia Herrich-Schäffer, 1870 (type species Pellicia dimidiata Herrich-Schäffer, 1870) reveals their taxonomic identity and previous misidentifications. As a result, we propose many new synonymies and reinstate several species. However, working with a small sample of specimens and not being able to find primary types of some taxa leaves us with several unanswered questions to address. First, as we hypothesized (Zhang et al. 2023 c), North and Central American specimens previously identified as P. dimidiata Herrich-Schäffer, 1870 are distinct from South American specimens at the species level. We attributed the name P. dimidiata to the South American species based on the taxonomic identity of the syntype from Venezuela, but refrained from designating this syntype a lectotype, searching for possible syntypes from “ Mexico ”. We used the name Pellicia bilinea Mabille, 1889 (type locality in Panama: Chiriquí) as valid for the North and Central American species as the oldest name with a strongly supported taxonomic identity based on a syntype of P. bilinea we located. Here, taking the next step to stabilize nomenclature and define this name objectively, N. V. G. hereby designates a syntype in the MFNB collection that bears the following nine labels (1 st purple, others white; 3 rd to 6 th handwritten, others printed with handwritten text shown in italics): [Origin.], [Chiriqui | Ribbe], [Pellicia | bilinea | Mab.], [Pellicia | Bilinea | Mab.], [Bilinea | Mab.], [Gen. prep. | Mielke 1979], [Genital-Unters. | Nr. 4713 | Zool. Mus. Berlin], [{QR Code} http: // coll. mfn-berlin. de / u / | 940 b 91], [DNA sample ID: | NVG- 15032 E 01 | c / o Nick V. Grishin] as the lectotype of Pellicia bilinea Mabille, 1889. According to its label, the lectotype was collected in Chiriquí, Panama, by Carl Ribbe. The 3 rd and the 4 th labels are in Mabille’s and Staudinger’s handwriting, respectively. The lectotype has minor damage to its left hindwing fringe in the middle and at the tornus. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15032 E 01, GenBank PV 550040, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAGTAGGAACATCATTAAGTTTAATTATTCGATCCGAATTAGGTACCCCTAGATCTTTTATTGGAGATGATCAAATTTATAATACC ATTGTAACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCTCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGACTTTTACCTCCTTCTATTACTCTATTAATTTCAAGAAGTTTTGTAGAAAATGGTGTTGGTACAGGTTGAACTGTTTATCCTCCTTTATCTGCTAATATTGC TCATCAAGGTTCTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACAACCATTATTAATATACGAATTAACAATTTATTA TTTGATCAAATACCTTTATTTATTTGAGCTGTTGGAATTACAGCTTTACTTTTATTACTATCTCTACCAGTTTTAGCTGGAGCTATTACCATATTATTAACTGATCGAAATCTTAATACAT CTTTTTTTGACCCTGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT However, an older name, Achlyodes nivonicus Plötz, 1884 (type locality in Mexico) might apply to P. bilinea and become valid for this taxon. According to Godman (1907), A. nivonicus “ is doubtless the female of ” P. dimidiata (the name Godman used for Mexican specimens) and it was “ figured from a damaged specimen ” by Plötz, meaning that the illustrated syntype was a female from Mexico, appeared damaged, and was similar to P. bilinea. However, we are not positive about Godman’s synonymy. The original description of A. nivonicus might equally well, if not better, apply to a female of Viuria licisca (Plötz, 1882) (type locality in Nicaragua, the name proposed for male specimen (s )), or even to some damaged female of a Mexican Quadrus (Ouleus Lindsey, 1925) resembling its type species Quadrus (Ouleus) fridericus fridericus (Geyer, 1832) (type locality in Suriname). The description of A. nivonicus is brief and states (assembled from the key and translated): “ Forewing without subapical hyaline spots. The outer margin of all wings is smooth and rounded. Hindwing beneath evenly brownish gray [meaning not paler towards tornus] with dark bands. Upperside black-brown, forewing with three even darker bands. The outer band of the forewing is broken up into spots ” (Plötz 1884). The closest species it was compared to was Achlyodes thiena Plötz, 1884 (no locality data), differing by the last sentence: “ The outer band of the forewing is complete, very indistinct. ” In MFNB, we located a likely syntype of A. thiena, which is Q. fridericus fridericus, as currently treated, a dark species as described by Plötz, with a weakly defined continuous dark band near the dorsal forewing margin. Therefore, A. nivonicus should have been dark as well, but P. bilinea females typically have paler brown ground color and narrower dark bands, thus not resembling Q. fridericus. Conversely, V. licisca females, which are patterned similarly to P. bilinea, are darker, with broader dark bands and sometimes with nearly dark-brown hindwings above (no pattern was mentioned by Plötz for the hindwing, and the hindwing of A. thiena syntype is nearly uniformly dark brown). Both P. bilinea and V. licisca may have a dark marginal band broken up into spots. It is also possible that it might have been a species known today as Quadrus (Ouleus) salvina (Evans, 1953), which is somewhat similar to Q. fridericus, or some mislabeled and damaged female of another species. To solve this problem, we are searching for syntypes of A. nivonicus and specimens from Mexico that agree with all the information about this taxon as candidates for a neotype. Presently, we tentatively place Achlyodes nivonicus Plötz, 1884 as a junior subjective synonym of Viuria licisca (Plötz, 1882), because the latter species agrees best with the original description of the former. Second, we sequenced rather few specimens of Pellicia. While our results confidently resolve the taxonomic identity of primary type specimens and are sufficient to support our major conclusion, further studies are expected to clarify species vs. subspecies boundaries in Pellicia. We observe noticeable genitalic differences for taxa that are rather similar genetically. Sequencing a larger series of specimens of each taxon will enable us to study intra- vs. interspecies genetic differentiation and explain the apparent lack of COI barcode differences and relatively small nuclear genome differences between several species distinct in genitalia. Third, adding not yet sequenced taxa of Pellicia to the analysis will help us find their place in the taxonomic list and may result in further synonymization of names proposed by Evans (1953), who misidentified the majority of Pellicia taxa, or reinstatement of some species currently treated as synonyms.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF97280FE6BFB18A815FCEC.taxon	description	http: // zoobank. org / DB 2 C 8820 - 6477 - 4 AF 8 - B 492 - 4 A 0 E 33 E 7 F 758 (Figs. 94 part, 95, 96 a – c)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF97280FE6BFB18A815FCEC.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 95 (genitalia Fig. 96 a – c), bears the following five printed (text in italics handwritten) rectangular labels, four white: [PERU: Cuzco, 564 m. | Pilcopata | Cosnipata Rd 021 | 15 - XI- 2008 Kinyon], [DNA sample ID: | NVG- 7975 | c / o Nick V. Grishin], [genitalia | NVG 170207 - 60 | Nick V. Grishin], [USNMENT | {QR Code} | 01321815], and one red [HOLOTYPE ♂ | Gorgopas | trochicuz Grishin]. Paratype: 1 ♂ NVG- 24065 B 06 Peru, Cuzco, Pilcopata, 600 m, 15 - 18 - Dec- 1979, J. B. Heppner leg. [MGCL]. Type locality. Peru: Cuzco, Cosñipata Road, Pilcopata, elevation 564 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF97280FE6BFB18A815FCEC.taxon	etymology	Etymology. The name is a fusion: trochi [lus] + Cuz [co} (for the type locality) and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF97280FE6BFB18A815FCEC.taxon	distribution	Distribution. Currently known only from the type locality, which is to the northeast of the Andes in southern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF77281FD91FCF4AA98FA81.taxon	description	(Figs. 94 part, 97 – 98)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF77281FD91FCF4AA98FA81.taxon	diagnosis	Definition and diagnosis. In addition to the new species described above, specimens from Colombia are genetically differentiated from Gorgopas trochilus (Hopffer, 1874) (type locality in Bolivia, holotype sequenced as NVG- 15032 D 07) at the species level (Fig. 94); e. g., their Fst / COI barcode differences are 0.45 / 1.5 % (10 bp), and, therefore, represent a new species. This new species keys to G. trochilus (E. 28.1) in Evans (1953) but differs from it and the new species described above by being paler, with a more strongly defined contrast between darker brown and paler brown areas giving the dorsal hindwing a checkered appearance, somewhat weaker green overscaling, broader wings, more trapezoidal hindwings, broader valvae and even stronger defined sclerotized inner lobe of harpe. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1139.17.3: A 54 G, aly 1139.17.3: G 60 A, aly 1042.31.2: C 89 T, aly 1042.31.2: A 102 T, aly 96.3.7: T 51 C; and COI barcode: T 46 C, 220 C, C 340 C, T 400 C, T 415 A, C 536 T. Barcode sequence of the holotype. Sample NVG- 23055 H 03, GenBank PV 550042, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACCTCTTTAAGTATTCTTATTCGATCAGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTCTTTCAGCTAATATTGC TCATCAAGGTTCTTCAGTAGATTTAACTATTTTTTCCCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAAATTATCA TTTGATCAAATATCCTTATTTATTTGAGCTGTAGGAATTACTGCATTACTTTTATTATTATCTTTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATCTTAATACAT CTTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF77281FD91FCF4AA98FA81.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 97 (genitalia in Fig. 98), bears the following six printed rectangular labels, five white: [COLOMBIA: TOLIMA | La Marina area, Rio | Ambeima, 1600 - 1700 m. | 7. vi. 1974 | S. & L. Steinhauser], [A. C. Allyn | Acc. 1974 - 23], [DNA sample ID: | NVG- 23055 H 03 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24065 B 04 | c / o Nick V. Grishin], [genitalia: | NVG 241111 - 16 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Gorgopas | trocha Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1 ♂ NVG- 23055 H 02 the same data as the holotype but collected on 12 - Jun- 1974. Type locality. Colombia: Tolima, La Marina area, Rio Ambeima, elevation 1600 – 1700 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF77281FD91FCF4AA98FA81.taxon	etymology	Etymology. The name is formed from the name of its relative, G. trochilus, made shorter to indicate the more northern distribution locality of this species, and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF77281FD91FCF4AA98FA81.taxon	distribution	Distribution. Currently known only from Tolima in Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF67282FE79FA15AA89F91B.taxon	description	(Figs. 94 part, 99 – 100)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF67282FE79FA15AA89F91B.taxon	diagnosis	Definition and diagnosis. In addition to the two new species described above, specimens from Argentina are genetically differentiated from Gorgopas trochilus (Hopffer, 1874) (type locality in Bolivia, holotype sequenced as NVG- 15032 D 07) at the species level (Fig. 94); e. g., their Fst / COI barcode differences are 0.51 / 1.7 % (11 bp), and, therefore, represent a new species. This new species keys to G. trochilus (E. 28.1) in Evans (1953) but differs from it and the two new species described above by being paler, with a more strongly defined contrast between darker brown and paler brown areas giving the dorsal hindwing a checkered appearance, significantly weaker green overscaling that on the hindwing is nearly vestigial and constrained to the very base, more pointed forewings, broader valvae with a slightly smaller and less distinct sclerotized inner lobe of harpe. Due to the cryptic nature of this species and unexplored individual variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 251.9.2: G 45 A, aly 251.9.2: G 57 A, aly 320.2.32: C 36 T, aly 320.2.32: G 48 A, aly 1139.31.4: G 1091 T; and COI barcode: C 187 C, C 340 T, T 382 T, T 499 C, 598 A. Barcode sequence of the holotype. Sample NVG- 23055 H 09, GenBank PV 550043, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGATCTGGAATAATTGGAACTTCTTTAAGTATTCTTATTCGATCAGAATTAGGAACTCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTCTTATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCCCCTCTTTCAGCTAATATTGC TCATCAAGGTTCTTCAGTTGATTTAACTATTTTTTCTCTTCATTTAGCAGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAAATTATCA TTTGATCAAATATCCTTATTTATTTGAGCTGTAGGAATTACTGCATTACTTCTATTATTATCTTTACCAGTTTTAGCAGGTGCAATTACTATATTATTAACTGATCGAAATCTAAATACAT CTTTTTTTGACCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF67282FE79FA15AA89F91B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 99 (genitalia in Fig. 100), bears the following five printed rectangular labels, four white: [Baritú Lodge | Salta, Argentina | S 22 ° 37.953 ’; W 64 ° 26.612 ’ | elevation 2112 ft. | November 17, 2003 | D. L Lindsley], [Gorgopas Godman & Salvin | tröchilus (Hopffer)], [D. L. Lindsley colln. | MGCL Accession | # 2008 - 20], [DNA sample ID: | NVG- 23055 H 09 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Gorgopas | trochitango Grishin]. An unnumbered vial with genitalia, likely dissected by D. L. Lindsley, is pinned between the labels of the holotype. Paratypes: 3 ♂♂ from Argentina, R. Eisele leg. [MGCL]: 2 ♂♂ NVG- 24065 B 07 and NVG- 23055 H 08 Jujuy, Ledesma, Calilegua, Rt. 83. 5 – 7.5 km W of Rt. 34, 550 - 600 m, 4 - Apr- 1991 and 1 ♂ NVG- 24065 B 08 Salta, Sierra de Tartagal, Rio Yacuy, 14 km W of Rt. 34, 800 m, 10 - Apr- 1975. Type locality. Argentina: Salta, Baritú Lodge, elevation 2112 ft, GPS − 22.6326, − 64.4435.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF67282FE79FA15AA89F91B.taxon	etymology	Etymology. The name is a fusion: trochi [lus] + tango (strongly associated with Argentina, for the type locality) and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF67282FE79FA15AA89F91B.taxon	distribution	Distribution. Currently known only from northern Argentina.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF57283FE8DF882ABF2FA88.taxon	discussion	Recently, we proposed that the genus Clytius Grishin, 2019 (type species Pholisora clytius Godman & Salvin, 1897) consists of five species: Clytius clytius (Godman & Salvin, 1897) (type locality in Mexico: Nayarit, Tres Marias Island, syntype sequenced as NVG- 18082 E 10), Clytius semitincta (Dyar, 1924) (type locality in Colima, syntypes sequenced as ♂ NVG- 15109 B 06 and ♀ NVG- 15109 C 12), Clytius mattus Grishin, 2024 (type locality USA: Hidalgo Co., Bentsen-Rio Grande Valley State Park, holotype sequenced as NVG- 5486), Clytius unifascia (Mabille, 1889) (type locality Honduras, lectotype sequenced as NVG- 15033 G 05), and Clytius shola (Evans, 1953) (type locality not specified, likely in Venezuela) (Zhang et al. 2022 b; Zhang et al. 2024 b). To stabilize nomenclature and define the name C. clytius objectively, N. V. G. hereby designates a syntype in the BMNH collection, a male that bears the following twelve labels (first two and the last round, others rectangular; first two with a red circle on one side, last yellow, others white; 7 th, 9 th, and 12 th handwritten, others printed): (Type), (Type) and on the other side of this label handwritten (H | 737), [Tres Marias Is., | W. Mexico. | Forrer.], [♂], [Sp. figured.], [B. C. A. Lep. Rhop. | Pholisora | clytius, | G. & S.], [Pholisora | clytius sp. n | Type Figd], [Godman-Salvin | Coll. 1912. — 23.], [D 10] with genitalia pieces glued to this label, [{QR Code} | BMNH (E) 1669520], [MOLECULAR | 0247274691], (426) as the lectotype of Pholisora clytius Godman & Salvin, 1897. The lectotype’s right hindwing has a tear at the outer margin near the apex where a tiny wing segment is folded down. Images of this specimen photographed by N. V. G. are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 18082 E 10, molecular NHMUK _ 0247274691, GenBank ON 480064, PV 550044, 658 base pairs, is: AACTTTATACTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTTTAAGTATATTAATTCGTTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCAGCTAATATTGC TCACCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCT TTCGATCAAATACCTTTATTCGTATGAGCTGTAGGAATCACAGCTTTACTTTTACTTTTATCTCTACCAGTTTTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATCTTAATACAT CTTTTTTTGATCCTGCTGGTGGAGGTGATCCTATTTTATATCAACATTTATTT To stabilize nomenclature and define the name C. semitincta objectively, N. V. G. hereby designates a syntype in the USNM collection, a male that bears the following six rectangular labels (1 st and 5 th handwritten, others printed with handwritten text shown in italics; 4 th red and others white): [Colima | Mex.], [Dec | 1922], [RMuller | Collector], [TypeNo. | | U. S. N. M.] no type number is given on the label, [Bolla | semitincta | Type Dyar], [GENITALIA NO. | X- 32 14 | J. M. Burns 199 1] as the lectotype of Bolla semitincta Dyar, 1924. The lectotype is missing the left antenna, has its head turned to the left, and both costal folds are partly opened from the base. Images of this specimen photographed by Bernard Hermier (and N. V. G.) are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15109 B 06, GenBank PV 550045, 658 base pairs, is: AACTTTATACTTTATTTTTGGTATTTGGTCTGGTATAGTAGGAACTTCTTTAAGAATATTAATTCGTTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCAGCTAATATTGC TCATCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCTTTACATTTAGCTGGAATTTCCTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATGCGAATTAATAATTTATCT TTCGATCAAATACCTTTATTTGTATGAGCTGTGGGAATTACAGCTTTACTTTTACTCTTATCTCTACCAGTTTTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATCTTAACACAT CTTTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF47286FE69FA1AAD18FEC5.taxon	description	http: // zoobank. org / 445 F 016 E- 851 C- 4 B 10 - B 4 EC- 2853 F 968 CA 89 (Figs. 101 part, 102, 103 a – d)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF47286FE69FA1AAD18FEC5.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 102 a (genitalia in Fig. 103 a, b), bears the following five printed rectangular labels, four white: [PERU, AM, 3 km | S Abra Chanchillo | 06 ° 49 ' S, 77 ° 57 ' W | 19. ix. 99, 2150 m | Robbins, Lamas, Ahrenholz], [DNA sample ID: | NVG- 7826 | c / o Nick V. Grishin], [genitalia | NVG 170206 - 11 | Nick V. Grishin], [USNMENT | {QR Code} | 01321666], and one red [HOLOTYPE ♂ | Perus (Perus) | perus Grishin]. Fringes of the holotype are rather evenly damaged, giving it a somewhat unusual appearance. Paratypes: 2 ♂♂ and 1 ♀ from Peru, La Libertad Region, Angasmarca, old [USNM]: 1 ♂ NVG- 18058 H 06 (leg DNA extraction, sequenced), NVG- 23121 C 11 (abdomen DNA extraction and dissection), USNMENT 01466752, genitalia NVG 240817 - 74 (Figs. 102 b, 103 c, d); 1 ♂ NVG- 23121 F 02; and 1 ♀ NVG- 23121 E 12.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF47286FE69FA1AAD18FEC5.taxon	etymology	Etymology. For this new species from Peru, the name is tautonymous with the genus name and is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF47286FE69FA1AAD18FEC5.taxon	distribution	Distribution. Currently known from the Andean region in northern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF17287FE13FEAAA8A5FE90.taxon	discussion	Genomic analysis of Gomalia F. Moore, 1879 (type species Gomalia albofasciata F. Moore, 1879) specimens reveals that Gomalia jeanneli (Picard, 1949) (type locality in Kenya, holotype sequenced as NVG- 18079 B 11) is sister to Gomalia albofasciata Moore, 1879 (type locality in Sri Lanka) (Fig. 104), COI barcode difference of 2.3 % (15 bp), and is more distantly related to Gomalia elma (Trimen, 1862) (type locality in South Africa) with which it is likely sympatric in Kenya, COI barcode difference of 6.4 % (42 bp). Moreover, Gomalia elma levana Benyamini, 1990 (type locality in Israel) clusters closely with G. jeanneli and not with G. elma, not being strongly differentiated genetically from the former (Fig. 104); e. g., their COI barcodes differ by 0.9 % (6 bp). Therefore, not having sufficient evidence to treat G. elma levana as a species-level taxon, we place it as a subspecies of G. jeanneli, instead of G. elma as originally proposed, to form a new species-subspecies combination: Gomalia jeanneli levana Benyamini, 1990. Thus far, we have only sequenced two specimens of G. jeanneli: the holotype from Kenya (see fig. 3 in Zhang et al. (2020 a )) and another specimen from Ethiopia (Fig. 105 a). Both specimens are males, are dark brown without the pale pattern characteristic of Gomalia, and are smaller than G. elma (Fig. 106 c, d), similar in size to G. jeanneli levana (Fig. 105 b). It is unclear whether all nominate G. jeanneli are small and brown like this, or if it is just a color form, and pale-patterned specimens of larger size exist in these populations.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF07287FE87FE08AAE6FB84.taxon	discussion	Genomic analysis of Gomalia F. Moore, 1879 (type species Gomalia albofasciata F. Moore, 1879) specimens from Oman and Yemen reveals that they partition into two clades (Fig. 104). One male (NVG- 24054 D 01, Oman, Rustaq, 5 - Mar- 1979, T. B. Larsen leg. [ZMUC], Fig. 105 b) is placed with Gomalia jeanneli levana Benyamini, 1990 (type locality in Israel), is phenotypically similar to it in being ventrally pale with a diffuse cream band and small size, and we identify it as this subspecies. Other specimens (T. B. Larsen leg. in ZMUC from Oman: 1 ♂ NVG- 24054 B 04 Al Batinah Region, Barka 4 - Mar- 1979, Fig. 105 c and 1 ♀ NVG- 24054 B 05 Rustaq, 5 - Mar- 1979, Fig. 105 d, and 1 ♂ NVG- 24054 B 06 Yemen, Wadi Dahr, N of Sana'a, 10 - May- 1980) are larger, with more extensive and better-defined cream bands, and are in the clade with Gomalia elma (Trimen, 1862) (type locality in South Africa) (Fig. 106 c, d), thus being more distant from G. albofasciata (type locality in Sri Lanka) (Fig. 105 e) and Gomalia jeanneli (Picard, 1949) (type locality in Kenya) (Fig. 105 a), and are genetically differentiated from them all at the species level (Fig. 104), e. g., their COI barcodes differ by 1.7 % (11 bp) from G. elma and by 5.6 % (37 bp) from G. albofasciata. Therefore, these specimens represent a distinct species that we identified as Gomalia litoralis Swinhoe, 1885 (type locality Pakistan: Karachi), which is currently treated as a junior subjective synonym of G. albofasciata. Therefore, we propose that Gomalia litoralis Swinhoe, 1885, stat. rest. is a valid species distinct from Gomalia albofasciata F. Moore, 1879.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF0729BFD98FB16ADC1FF11.taxon	description	http: // zoobank. org / 88 CD 5 D 4 F-C 4 D 4 - 4 D 29 - 8724 - D 379 F 4654 CC 9 (Figs. 104 part, 106 a – b, 107 a)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF0729BFD98FB16ADC1FF11.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 106 a, bears the following five printed (text in italics handwritten) rectangular labels (3 rd green, 5 th red, others white) [GHANA | Likpe | 22 - xi - 196 8 | Fr. Th. Maessen], [A. C. Allyn | Acc. 1969 - 6], [{QR Code} UF | FLMNH | MGCL 1162140], [DNA sample ID: | NVG- 24066 B 03 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Gomalia westafra | Grishin]. Paratypes: 4 ♂♂ and 4 ♀♀: 1 ♂ NVG- 24066 B 01, UF FLMNH MGCL 1162125 Côte d'Ivoire, Bouake, 25 - Mar- 1974, E. Munroe leg. [MGCL]; Ghana, the same data as the holotype except as specified: 1 ♂ NVG- 24066 B 02, UF FLMNH MGCL 1162130, 6 - Jul- 1970, genitalia NVG 241111 - 27 (Fig. 107 a); 1 ♀ NVG- 24066 B 04, UF FLMNH MGCL 1162146, 7 - May- 1980; and 1 ♀ NVG- 24066 B 05, UF FLMNH MGCL 1162148 Hohoe instead of Likpe, 1 - Jul- 1956; Nigeria: 1 ♂ NVG- 17092 B 09, USNMENT 00894593 Oyo State, Ibadan, May-Jun- 1951, H. J. Sutton leg. [USNM] and 1 ♀ NVG- 24054 B 03 Nigeria, Lagos State, Isheri, 5 - Oct- 1980, H. Kapala leg. [ZMUC]; and West Africa (no detailed locality, old specimens): 1 ♂ NVG- 19046 G 11, AMNH _ IZC 00346646 [AMNH] and 1 ♀ NVG- 17069 F 08, USNMENT 00894397 [USNM]. Type locality. Ghana: Oti Region, Likpe.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF0729BFD98FB16ADC1FF11.taxon	etymology	Etymology. The name is given for the West African distribution of this species and is a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BF0729BFD98FB16ADC1FF11.taxon	distribution	Distribution. Western Africa, currently known from Côte d'Ivoire, Ghana, and Nigeria.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEC729DFE80FECCABF2FD92.taxon	discussion	Carterocephalus biseriatus Weymer, 1890 was described from two specimens from the high plateau in Bolivia and illustrated in the original description as reproduced here in Fig. 108 a (Weymer and Maassen 1890). Evans (1953) synonymized this name with Hesperia (Syrichthus [sic]) limbata Erschoff, 1876, the type of and currently a valid species in the genus Chirgus Grishin, 2019. We located and sequenced a syntype (labeled as “ Lectotypus ”, although this designation was not published) (Fig. 108 b) and a specimen identified as C. biseriatus placed next to the syntype in the drawer (Fig. 108 c). Phylogenetic trees constructed from protein-coding genes in the nuclear genomes revealed that the two specimens were not conspecific (Fig. 109). The syntype was grouped with the specimens of Chirgus barrosi (Ureta, 1956) (type locality in Chile), and the other specimen was placed among Chirgus nigella (Weeks, 1902) (type locality in Bolivia). Phenotypic inspection agreed with this conclusion, and differing ventral wing patterns of the specimens were consistent with such placement (Fig. 108 b, d vs. c). Evans’s (1953) decision to synonymize Carterocephalus biseriatus with C. limbata instead of C. nigella was probably due to the original description and illustration (Evans did not have a chance to inspect the syntype) indicating a single pale spot on the brown ground color of the dorsal hindwing (more consistent with C. limbata) (Fig. 108 a), while both the syntype and the other specimen exhibit more extensive pale patterns (more characteristic of C. nigella) (Fig. 108 b, c). The other specimen, although being from the Maassen collection and identified as C. biseriatus, is not likely to be a syntype because it has antennae intact, but the original description states that both syntypes lacked the antennae (Weymer and Maassen 1890). Moreover, judging from the handwriting, the identification label placed on this specimen was written by a different person, possibly by Mabille (after publication of the name), while the identification label on the syntype may have been written by Weymer, based on the handwriting on these labels. Conversely, the syntype we found agrees well with the original description and illustration of C. biseriatus. It is even possible that the ventral side illustration shows the right wings of this syntype: the hindwing has two rows of spots (3 and 5 spots), uniformly ochre-yellow otherwise, and the forewing is paler in the discal area than typical for this species. The artist might have mistaken the scale damage on this forewing for the pattern and illustrated a broader pale band instead of a narrow band of smaller pale spots. The dorsal side illustration is not particularly similar to this syntype: it is darker with much smaller pale spots and only one central spot on the hindwing. It might have depicted the second syntype (possibly not even conspecific with the first one), which we could not locate. To stabilize nomenclature and define the name C. biseriatus objectively, N. V. G. hereby designates a syntype we found in the MFNB collection (shown in Fig. 108 b) with the following eight rectangular labels (1 st red, others white): [Lectotypus], [3083], [Coll. | Stübel], [Tacora], [Bolivien | Hochplateau | 3600 - 4600 m.], [Carterocephalus biseriatus Weym], [{QR Code} http: // coll. mfn-berlin. de / u / | 80 a 6 f 2], and [DNA sample ID: | NVG- 15033 H 08 | c / o Nick V. Grishin] as the lectotype of Carterocephalus biseriatus Weymer, 1890. The lectotype has scales rubbed off on both sides in the discal area of the right forewing, a feature even depicted in the original illustration of the ventral side (Weymer & Maassen, 1890: pl. 4, fig. 7). Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15033 H 08, GenBank PV 550048, 658 base pairs, is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACTTCATTAAGTTTATTAATTCGAACTGAATTAGGAAATCCAGGATCCTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGTGGATTCGGAAATTGATTAGTACCATTAATACTAGGAGCTCCAGATATAGCTTTTCCTCGAA TAAATAATATAAGATTTTGATTATTACCTCCTTCATTAACATTACTTATTTCAAGTAGTATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCTCTTTCAGCTAATATTGC CCATCAAGGTTCTTCTGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCCTTACTTCTTTTATTATCATTGCCTGTTTTAGCAGGAGCTATTACAATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGATCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEA729DFEEDFD1FAB95FC2F.taxon	discussion	Genomic analysis of the lectotype of Carterocephalus biseriatus Weymer, 1890 (type locality in Bolivia, sequenced as NVG- 15033 H 08) reveals that it belongs to a different clade than Chirgus limbata (Erschoff, 1876) (type locality in Peru), is confidently placed as sister to Chirgus nigella (Weeks, 1902) (type locality in Bolivia) in the Z chromosome tree, and is genetically differentiated from them at the species level (Fig. 109), e. g., the COI barcodes of C. biseriatus and C. nigella differ by 2.3 % (15 bp). Therefore, we propose that Chirgus (Chirgus) biseriatus (Weymer, 1890), stat. rest. is a species distinct from Chirgus (Chirgus) limbata (Erschoff, 1876).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEA729DFE4AFB89AAF6FA03.taxon	discussion	Genomic phylogeny that includes several specimens of Chirgus biseriatus (Weymer, 1890) (type locality in Bolivia, lectotype sequenced as NVG- 15033 H 08, brown ground color of dorsal hindwing) and Chirgus barrosi (Ureta, 1956) (type locality in Chile, several topotypical paratypes sequenced, cream and nearly unmarked dorsal hindwing) reveals the lack of separation between them in nuclear genomes, although the mitochondrial genomes partition them into different clades (Fig. 109). Due to the lack of nuclear genomic differentiation, we propose to treat these two taxa as subspecies with the junior name being Chirgus (Chirgus) biseriatus barrosi Ureta, 1956, stat. nov. In summary, we show that C. biseriatus is not a synonym of C. limbata, but a species previously known as C. barrosi, which, due to wing pattern differences and separate geographic ranges, becomes a subspecies.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEA729FFE3DFA6CA8FDFF39.taxon	description	http: // zoobank. org / 6 D 8855 C 3 - 80 A 6 - 4 F 0 F- 8461 - 517 F 01 A 8427 A (Figs. 109 part, 110 – 111)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEA729FFE3DFA6CA8FDFF39.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 110 (genitalia Fig. 111), bears the following seven rectangular labels (2 handwritten, others printed), six white: [ARGENTINA Jujuy | (Tumbaya) | Purmamarca to Rt. | 40, Rt 52 km 38, | 4170 m 21 - i- 88 Leg | R Eisele 88 J 5], [♂], [MGCL Accession | # 2011 - 4 | Robert Eisele], [DNA sample ID: | NVG- 15092 G 11 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24068 C 09 | c / o Nick V. Grishin], [genitalia: | NVG 241111 - 32 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chirgus (Chirgus) | argentinus Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratype: 1 ♀ NVG- 24068 C 08 Argentina, Jujuy, Tilcara Department, Cerro Sisilera, 15 km SE of Huacalera, 4550 m, 20 - Dec- 1990, David Greenman leg. [MGCL]. Type locality. Argentina: Jujuy Province, Tumbaya Department, Purmamarca to Rt. 40, km 38 of Rt. 52, elevation 4170 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEA729FFE3DFA6CA8FDFF39.taxon	etymology	Etymology. The name refers to the country with the type locality and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEA729FFE3DFA6CA8FDFF39.taxon	distribution	Distribution. Argentina.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BEA729FFE3DFA6CA8FDFF39.taxon	discussion	Comment. Published records of Chirgus limbata from Argentina (Gomariz 2020; Núñez-Bustos 2023) likely refer to this species.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE8729FFEEDFEA4AD5AFD57.taxon	discussion	Genomic phylogeny reveals that in all three trees Scelothrix [sic] trisignatus Mabille, 1875 (type locality Chile: Valparaiso), currently treated as a subspecies of Chirgus (Chirgus) bocchoris (Hewitson, 1874) (type locality in Bolivia) (Fig. 109 aquamarine), is strongly differentiated from it genetically (Fig. 109 blue), forming a distinct clade that includes specimens throughout the range. The Z chromosome Fst of the two taxa is 0.44, their COI barcodes differ by 1.4 % (9 bp), and they possess distinct wing patterns as detailed by Evans (1953). Therefore, we propose that Chirgus (Chirgus) trisignatus (Mabille, 1875), stat. rest. is a species distinct from Chirgus (Chirgus) bocchoris (Hewitson, 1874).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE8729FFE8DFD53AD21FAB3.taxon	discussion	Genomic analysis of the lectotype of Hesperia (Battus) cuzcona Draudt, 1923 (type locality in Peru: Cuzco, sequenced as NVG- 18093 A 12) places it within specimens of Chirgus (Chirgus) bocchoris bocchoris (Hewitson, 1874) (type locality in Bolivia) and away from several specimens from Cuzco in Peru that we identified as “ Chirgus bocchoris cuzcona ” using Evans (1953) (Fig. 109). Neither the Z chromosome (Fig. 109 b) nor the mitochondrial DNA trees (Fig. 109 c) reveal overall genetic differentiation between H. cuzcona lectotype and C. bocchoris bocchoris, suggesting that they are conspecific. However, the nuclear genome tree places the lectotype as sister to all other sequenced specimens of C. bocchoris bocchoris (none from Peru), implying some genetic uniqueness of Peruvian populations. Therefore, we propose to keep Hesperia (Battus) cuzcona Draudt, 1923, as a subspecies of Chirgus (Chirgus) bocchoris (Hewitson, 1874) pending further research. Curiously, the original description (English version) of H. cuzcona states: “ wings … above the white spots are a little more prominent … the spot of the hindwing oblong quadrangular ” (Draudt 1923), consistently with the wing pattern of the lectotype (Fig. 109) and the wing pattern of C. bocchoris, but contrary to how H. cuzcona was described (and consequently misidentified) later: “ Uph more or less unmarked ” (Evans 1953). Specimens from the Andes of Peru with unmarked hindwings that Evans (1953) misidentified as “ Pyrgus bocchoris cuzcona ” represent two new species that are described next.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE87290FE4BFA3FABBCFC7F.taxon	description	http: // zoobank. org / 9214666 A-C 343 - 4 E 07 - ADAE-E 5792 AA 61 A 1 F (Figs. 109 part, 112 – 113)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE87290FE4BFA3FABBCFC7F.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 112 (genitalia Fig. 113), bears the following six printed rectangular labels, five white: [12 km NNE La Oroya | 4100 - 4150 m | JuninPERU | Jack L. Harry | 14 Oct 2005], [MGCL Acc. | # 2015 - 47 | J. L. Harry] [DNA sample ID: | NVG- 23058 C 10 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24067 E 11 | c / o Nick V. Grishin], [genitalia: | NVG 241111 - 31 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chirgus (Chirgus) | teres Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 2 ♂♂ in Ernst Brockmann collection: NVG- 15083 E 03 from the type locality, 2000 and NVG- 15083 E 02 from Peru, Pasco Region, C. de Pasco, 4000 m, 2001. Type locality. Peru: Junín Region, 12 km north-northeast of La Oroya, elevation 4100 – 4150 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE87290FE4BFA3FABBCFC7F.taxon	etymology	Etymology. In Latin, teres means smooth or round, highlighting a curved form with a smooth surface. The name reflects the ventral hindwing pattern of smoother and rounder curves and smoother, not variegated, overscaling compared to the closest relatives of this species. The name is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE87290FE4BFA3FABBCFC7F.taxon	distribution	Distribution. The Andes of central Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE67292FE2CFF01AA0EFC23.taxon	description	http: // zoobank. org / B 729 E 05 D- 7 B 8 C- 4283 - 9 E 32 - 47 EF 5892 A 115 (Figs. 109 part, 114 – 115)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE67292FE2CFF01AA0EFC23.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 114, bears the following four printed (text in italics handwritten) rectangular labels, three white: [Ayaviri 4050 m | Colquejaua | PunoPERU | Jack L. Harry | 30 Oct 2005], [MGCL Acc. | # 2015 - 47 | J. L. Harry], [DNA sample ID: | NVG- 23058 C 12 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Chirgus (Chirgus) | sombrus Grishin]. Paratypes: 3 ♂♂ and 1 ♀: 2 ♂♂ from the type locality: NVG- 24068 C 10 the same data as the holotype [MGCL] and NVG- 17069 B 06 (leg DNA extraction, sequenced), NVG- 23119 F 10 (abdomen DNA extraction and dissection), USNMENT 01321973, James H. Baker collection, 14 - Feb- 1970, genitalia vial NVG 240817 - 61 (Fig. 115) [USNM]; and from Peru, Cuzco, R. F., B. D. Denno, M. J. Raupp leg. [MGCL]: 1 ♂ NVG- 15092 G 03 9 km N of Cuzco, Ruinas Tambomachay, 3500 m, 10 - Feb- 1980 and 1 ♀ NVG- 15092 G 04 (leg DNA extraction), NVG- 24067 E 10 (abdomen DNA extraction and dissection), 6 km N of Cuzco, Ruinas Qenqo, 3 - Mar- 1980, genitalia vial NVG 241111 - 30. Type locality. Peru: Puno Region, Melgar Province, Ayaviri, elevation 4050 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE67292FE2CFF01AA0EFC23.taxon	etymology	Etymology. In Spanish, sombra means shadow, given for the darker dorsal hindwing with a “ shaded ” central white patch that identifies this species. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE67292FE2CFF01AA0EFC23.taxon	distribution	Distribution. The Andes of southern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE67292FE2CFF01AA0EFC23.taxon	discussion	Comment. This species was previously referred to by the name Pyrgus bocchoris cuzcona (Draudt, 1923) (or Chirgus bocchoris cuzcona), a misidentification.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE57292FEFFFBB0ABBFFAA7.taxon	discussion	Genomic analysis of a topotype of Zopyrion subvariegata thyas Evans, 1953 (type locality in Peru: Amazonas, Chachapoyas), together with another specimen from Cajamarca, Peru, reveals that they are genetically differentiated from Zopyrion subvariegata subvariegata Hayward, 1942 (type locality in Ecuador) at the species level (Fig. 116); e. g., their COI barcodes differ by 5.3 % (35 bp). Therefore, we propose that Zopyrion (Zopyrion) thyas Evans, 1953, stat. nov. is a species distinct from Zopyrion (Zopyrion) subvariegata Hayward, 1942.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE57293FE8AFA08A9C0FF6C.taxon	discussion	Zopyrion sandace Godman & Salvin, 1896 was described from a series of specimens from several places in Guerrero, Mexico, and one specimen from Guatemala (Godman and Salvin 1896). To stabilize nomenclature, clarify the type locality, and define the name Z. sandace objectively, N. V. G. hereby designates a syntype in the BMNH collection that, according to its label, was illustrated by Godman and Salvin (1896), and bears the following eleven labels (first three and the last round, others rectangular; first three with a red circle, last yellow, others white; 7 th and the last handwritten, others printed): (Type), (Type), (Type) and on the other side of this label handwritten (H | 876), [R. Papagaio, | Guerrero, 1200 ft. | Oct. H. H. Smith.], [Sp. figured.], [♂], [Zopyrion | sandace, sp. n | Type Figd.], [B. C. A. Lep. Rhop. | Zopyrion | sandace, | G. & S.], [Godman-Salvin | Coll. 1912. — 23.], [] genitalia are glued to this label without text, (966) as the lectotype of Zopyrion sandace Godman & Salvin, 1896. The lectotype has the costal fold open on the right forewing and closed on the left forewing, wings are glued to the body, and a patch of scales is missing at the base of the left hindwing above (likely due to removal of a dried glue patch). Images of this specimen are shown on the Butterflies of America website (Warren et al. 2024). The type locality of Z. sandace becomes Mexico: Guerrero, Río Papagayo, elevation 1200 ft.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE47294FE2DFF7EAD44F98C.taxon	description	http: // zoobank. org / 7 B 0 DD 951 - B 5 E 8 - 49 AD- 8 A 50 - B 6 F 772 AD 4 F 3 E (Figs. 116 part, 117, 118 a – c)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE47294FE2DFF7EAD44F98C.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 177 (genitalia Fig. 118 a – c), bears the following four rectangular labels (1 st handwritten, others printed with handwritten text shown in italics), three white: [San Pedro Sula, | Honduras | 4 - VII- 1981 | Robert O. Lehman], [GENITALIA NO. | X- 43 80 | J. M. Burns 199 8], [DNA sample ID: | NVG- 19091 F 01 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Zopyrion (Zopyrion) | xerxes Grishin]. Type locality. Honduras: San Pedro Sula.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE47294FE2DFF7EAD44F98C.taxon	etymology	Etymology. Sandace was the sister of Xerxes I, a king of the Achaemenid Empire of Persia who ruled from 486 to 465 BC. It seems fitting to use the name xerxes for this new species whose sister was named sandace. The name is a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE47294FE2DFF7EAD44F98C.taxon	distribution	Distribution. Currently known only from the holotype collected in Honduras.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE37296FE48F913AC6BFB47.taxon	description	http: // zoobank. org / C 3887697 - B 08 C- 4 BD 4 - 9 A 8 B-B 2 E 76 F 59 D 016 (Figs. 119 part, 120 – 121)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE37296FE48F913AC6BFB47.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 120, bears the following five printed (text in italics handwritten) rectangular labels, four white: [La Libertad, El Sal. | 10 m. | 15 - XII- 72 | No. H- 6039 | Leg S. & L. Steinhauser], [ANISOCHORIA PEDALIODINA | BACCHUS Ev. ♂ | Det: S. R. Steinhauser], [A. C. Allyn | Acc. 1973 - 23], [DNA sample ID: | NVG- 23054 D 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Anisochoria | bacchoides Grishin]. Paratypes: 2 ♂♂ and 3 ♀♀: 1 ♂ NVG- 20062 H 03 (leg DNA extraction, sequenced), NVG- 24015 E 07 (abdomen DNA extraction and dissection) Mexico, Chiapas, Tuzantán, Rio Huixtla 7 mi N of Huixtla, 7 - Aug- 1988, J. Kemner leg., genitalia vial NVG 241114 - 13 (Fig. 121) [TMMC]; Guatemala, Santa Rosa, Guazacapán, ex coll. E. Le Moult [MGCL]: 1 ♂ NVG- 23054 D 04 5 - Apr- 1922 and 1 ♀ NVG- 23054 D 05 1 - Mar- 1923; and El Salvador: 1 ♀ NVG- 19091 G 08 Santa Tecla, 19 - Dec- 1953, Mauricio Salazar leg. [USNM] and 1 ♀ NVG- 23054 D 07 Rio El Molino, nr. Ahuachapán, S. and L. Steinhauser leg. [MGCL]. Type locality. El Salvador: La Libertad, elevation 10 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE37296FE48F913AC6BFB47.taxon	etymology	Etymology. The name is formed from the name of its sister species, A. bacchus, made longer for this more southern relative. The name is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE37296FE48F913AC6BFB47.taxon	distribution	Distribution. Currently known from southern Chiapas (Mexico), Guatemala, and El Salvador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE17297FF47FA92ABF2FEBF.taxon	discussion	Instead of the holotype, the COI barcode sequence of a paratype was given in the original description of Timochares fuscifasciata Grishin, 2024, because the holotype has not been sequenced yet. Since then, it has been sampled, its whole genome shotgun dataset obtained, and the following label added to the holotype: [DNA sample ID: | NVG- 24105 H 04 | c / o Nick V. Grishin]. Additional specimens of this species were also sequenced (Fig. 122). The COI barcode sequence of the holotype, sample NVG- 24105 H 04, GenBank PV 550054, 658 base pairs, is identical to the one reported for the paratype in the original description and is: AACTTTATACTTTATTTTTGGAATTTGGGCAGGAATAGTTGGAACTTCTCTAAGTCTTCTTATTCGAACTGAATTAGGAAATCCCGGATCCTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTATCCCCCCCTTTCAGCTAATATTGC ACATCAAGGTTCTTCTGTAGACTTAGCTATTTTTTCCCTACATTTAGCAGGTATTTCCTCAATTCTTGGAGCAATTAACTTTATTACAACAATTATTAATATGCGAATTAGAAATTTATCT TTTGACCAAATACCTTTATTTGTTTGAGCTGTTGGTATTACAGCATTACTTTTGTTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGACCGAAATCTTAATACAT CATTTTTTGACCCTGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BE07297FF21FD9AAB73FB57.taxon	discussion	Genomic analysis of Onespa Steinhauser, 1974 (type species Onespa nubis Steinhauser, 1974) reveals a surprise (Fig. 123). Despite phenotypic differences in both sexes, including slight differences in genitalia between Onespa brockorum Austin & A. Warren, 2009 (type locality in Mexico: Sonora) and Onespa gala (Godman, 1900) (type locality in Mexico: Veracruz, holotype sequenced as NVG- 18117 F 05) discussed by Austin and Warren (2009) (who nevertheless note “ Onespa brockorum is very similar to O. gala ”), we failed to find DNA differences between them typical of species-level taxa. The two species do not separate phylogenetically, i. e., they do not form prominent and strongly supported clades in any of the three trees: the nuclear genome (autosomes), the Z chromosome, and the mitochondrial genome. This is the first example we encountered when a pair of species with reported genitalic differences in both sexes (albeit rather minute in our opinion) do not form separate well-supported clades in the genomic trees, and it warrants a more detailed study. It is possible that the two taxa are subspecies (in genome-scale trees, valid subspecies do not always segregate into discrete clades), or they speciated only recently and have not gained sufficient overall genetic differentiation in the presence of reproductive isolation. Here, we bring this unusual example to the attention of the research community without proposing taxonomic changes to the current classification.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDF72A9FDBAFFFEAAAAFB8E.taxon	description	http: // zoobank. org / B 166 E 5 B 8 - 4 E 66 - 4798 - 9058 - ABB 3 E 797 B 5 F 7 (Figs. 123 part, 124 – 125)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDF72A9FDBAFFFEAAAAFB8E.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Carnegie Museum of Natural History, Pittsburgh, PA, USA (CMNH), illustrated in Fig. 124, bears the following seven rectangular labels (1 st handwritten, others printed with handwritten text shown in italics), six white: [Mo Coúo (Cerro | Pelón) Mpio. Yolox | Oaxaca, MEXICO | 2150 m. | E. C. Welling], [13 - IX - 19 61 | Collection of | Lee D. Miller], [L. & S. Miller | Coll. C. M. Acc. | 21269 & 21733], [GENITALIA NO. | X- 28 53 | J. M. Burns 199 0], [Buzyges nubis | ♂ (STEINHAUSER) | det. J. M. Burns 1990], [DNA sample ID: | NVG- 18118 E 02 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Onespa nuba | Grishin]. Paratypes: 1 ♂ and 3 ♀♀ from Mexico, Oaxaca: 1 ♀ NVG- 17092 D 06 3 mi S of Telea de Castro, 6000 ', 18 - Aug- 1990, John Kemner leg., genitalia X- 3070 J. M. Burns 1991 [USNM] and others from the same locality, collector and collection as the holotype: 1 ♂ NVG- 21107 D 04 12 - Sep- 1961, genitalia X- 2855 J. M. Burns 1990 (Fig. 125) and 2 ♀♀ 13 - Sep- 1961: NVG- 18118 E 03, genitalia X- 2854 J. M. Burns 1990 and NVG- 21107 D 05. Type locality. Mexico: Oaxaca, Mpio. de San Pedro Yólox, Cerro Pelón, elevation 2150 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDF72A9FDBAFFFEAAAAFB8E.taxon	etymology	Etymology. In Spanish, nube means cloud. The name of the new species has the same root as the name of its close sister, O. nubis (Latin for cloud, mist, haze), but is made shorter for its more northern relative. The name is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDF72A9FDBAFFFEAAAAFB8E.taxon	distribution	Distribution. Currently known only from Oaxaca, Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDE72ABFE3AFB1DABEAF90A.taxon	description	http: // zoobank. org / B 60 AB 082 - 28 E 4 - 4 B 12 - AA 0 F-FB 84 DBD 5 A 043 (Figs. 126 part, 127, 128 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDE72ABFE3AFB1DABEAF90A.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 127, bears the following six printed (text in italics handwritten) rectangular labels, five white: [TEXAS: | JEFF DAVIS COUNTY | Davis Mtns. | Fisher Hill 6141 '], [William W. & | Nadine M. McGuire | coll. 28 - VIII - 7 7], [Collection of | William W. McGuire], [FSCA | Florida State Collection | of Arthropods], [DNA sample ID: | NVG- 23049 B 09 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Hesperia pahaska | tehaska Grishin]. Paratypes: 7 ♂♂ and 5 ♀♀ in MGCL unless stated otherwise: USA, Texas: 1 ♂ NVG- 23051 B 03 Culberson Co., 12 mi S and 10 mi E of Van Horn, 11 - May- 1973, J. Harry leg.; Jeff Davis Co., Davis Mnts.: 1 ♂ NVG- 10967 SH 118 S of McDonald Observatory, GPS 30.6597, − 104.0232, 9 - Apr- 2018, N. V. Grishin leg. [UTSW], 1 ♀ NVG- 23049 B 10, 29 mi W of Fort Davis, 28 - Aug- 1977, W. W. & N. M. McGuire leg., and 1 ♀ NVG- 11128 SH 118 nr. Caldwell Ranch, GPS 30.736725, − 104.139271, 18 - May- 2018, N. V. Grishin & J. Zhang leg. [UTSW]; Presidio Co.: 1 ♂ NVG- 23049 B 04 3 mi N of Shafter, 29 - May- 1973, W. W. & N. M. McGuire and 1 ♀ NVG- 23049 B 05 Shafter, 9 - Jun- 1961, H. A. Freeman leg.; Brewster Co.: 1 ♂ NVG- 23051 A 01 10 mi N of Persimmon Gap, 26 - May- 2008, C. Bordelon & E. Knudson leg., 1 ♂ NVG- 23051 B 01 USH 90, ca 35 mi W of Sanderson, 8 - Jun- 1974, W. W. McGuire leg., and 1 ♀ NVG- 23051 B 02 USH 90, 14 mi E of Marathon, coll. 26 - Jul- 1977, ex ovum, W. W. & N. M. McGuire leg.; Pecos Co., USH 90, 20 mi W of Sanderson, W. W. McGuire leg.: 1 ♂ NVG- 23049 B 07 20 - May- 1973 and 1 ♀ NVG- 23049 B 08 9 - Jun- 1974; and 1 ♂ NVG- 23051 C 10 McCulloch Co., Heart of Texas Roadside, 24 - Apr- 1980, D. Bauer leg. Type locality. USA: Texas, Jeff Davis Co., Davis Mts., Fisher Hill, elevation 6141 ’, approx. GPS 30.6972, − 104.0967.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDE72ABFE3AFB1DABEAF90A.taxon	etymology	Etymology. The name is formed from the type locality and is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDE72ABFE3AFB1DABEAF90A.taxon	distribution	Distribution. Central to West Texas (USA).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDC72ADFE3DF96FAD1FFED3.taxon	description	http: // zoobank. org / 1 ADE 0404 - E 9 CA- 4 E 0 B- 9003 - A 0 A 325 B 6 CDBD (Figs. 126 part, 128 part, 129)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDC72ADFE3DF96FAD1FFED3.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 129, bears the following six rectangular labels (1 st handwritten, others printed), five white: [MEXICO. Hidalgo: | Rt. 85, 90.4 mi | N. Pachuca, 4 - Aug- 1981 | leg. Douglas Mullins], [Hesperia | pahaska williamsi | Lindsey | Det. W. W. McGuire], [Collection of | William W. McGuire], [FSCA | Florida State Collection | of Arthropods], [DNA sample ID: | NVG- 23049 G 08 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Hesperia pahaska | hidalgo Grishin]. Paratype: 1 ♂ NVG- 24097 G 03 with the same data as the holotype. Type locality. Mexico: Hidalgo, Rt. 85, 90.4 mi north of Pachuca.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDC72ADFE3DF96FAD1FFED3.taxon	etymology	Etymology. The name of the state with the type locality is used as the name of the new subspecies and is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDC72ADFE3DF96FAD1FFED3.taxon	distribution	Distribution. Currently known only from the state of Hidalgo in Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDA72AEFE0AFEC0ABE7FEC5.taxon	description	http: // zoobank. org / 4 F 174661 - E 48 E- 4 C 06 - AB 91 - B 2451395772 F (Figs. 126 part, 128 part, 130)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDA72AEFE0AFEC0ABE7FEC5.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 130, bears the following six rectangular labels (2 nd handwritten, others printed with handwritten text shown in italics), five white: [MEXICO. | Baja California Norte: | 6 mi. NW Laguna Hanson, | Sierra Juarez, 22 - Jun- 1980 | leg WW McGuire], [+], [Collection of | William W. McGuire], [FSCA | Florida State Collection | of Arthropods], [DNA sample ID: | NVG- 23049 G 10 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Hesperia pahaska | bajanorta Grishin]. Paratypes: 8 ♂♂ the same data as the holotype, except as indicated: 7 ♂♂ NVG- 23049 G 11, NVG- 23049 H 01, and five not sampled for DNA; and 1 ♂ NVG- 23049 G 12 4 Jun- 1980.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDA72AEFE0AFEC0ABE7FEC5.taxon	etymology	Etymology. The name is formed from the name of the Mexican state with the type locality and is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BDA72AEFE0AFEC0ABE7FEC5.taxon	distribution	Distribution. Mexico: Baja California Norte.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD972AEFDACFDDCABC9FB0E.taxon	description	http: // zoobank. org / C 5 B 39850 - C 8 BB- 42 CB-AD 5 A- 514584 AEE 3 DB	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD972AEFDACFDDCABC9FB0E.taxon	type_taxon	Type species. Poanes batesi Bell, 1935.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD972AEFDACFDDCABC9FB0E.taxon	description	Definition. In the genomic phylogeny of Ochlodes Scudder, 1872, the first prominent clade, which is sister to the rest, currently includes a single species, the only member of the genus from the Caribbean Islands, and represents a new subgenus (Fig. 131). This new subgenus differs from its relatives by a combination of the following characters: the two parts of the stigma are aligned perfectly with each other (the end of one is not offset compared to the beginning of the other), ventral hindwing and the apex of ventral forewing are green-colored, valva with a larger cleft between harpe and ampulla, the aedeagus is broad, without a long style but with a long pack of cornuti. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 536.34.1: T 45 A, aly 216.67.2: A 123 G, aly 72.25.3: G 69 A, aly 1113.24.1: G 617 A, aly 727.16.4: T 106 C; and in COI barcode: T 46 A, A 76 G, A 280 G, T 379 C, T 424 A.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD972AEFDACFDDCABC9FB0E.taxon	etymology	Etymology. The name is a fusion of the names of the genus and the type species of the subgenus (first syllable): Ochlo [des] + ba [tesi]. The name is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD972AEFDACFDDCABC9FB0E.taxon	discussion	Species included. Only the type species (i. e., Poanes batesi Bell, 1935). Parent taxon. Genus Ochlodes Scudder, 1872.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD972AEFED0FEAAACFFFDC2.taxon	discussion	Inspection of the genomic phylogeny of Hesperiina reveals that the genus Ochlodes Scudder, 1872 (type species Hesperia nemorum Boisduval, 1852, currently regarded as a subspecies of Hesperia agricola Boisduval, 1852) experienced deep radiation (Fig. 131) and consists of four major clades. We define these clades as subgenera, three of which do not have available names and, therefore, are new, described below.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDA0FF0FABC9FBE7.taxon	description	http: // zoobank. org / 6 E 20 DE 25 - 20 C 7 - 4367 - 8 A 95 - 0 FE 0044 C 2 C 88	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDA0FF0FABC9FBE7.taxon	type_taxon	Type species. Hesperia venata Bremer & Grey, 1853.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDA0FF0FABC9FBE7.taxon	description	Definition. In the genomic phylogeny of Ochlodes Scudder, 1872, the last prominent clade consists of all Old World species and represents a new subgenus (Fig. 131). This new subgenus differs from its relatives by a combination of the following characters: the two parts of the stigma are at least slightly offset from each other; ventral hindwing and the apex of ventral forewing are yellow to brown, sometimes with olive overscaling but not bright-green; valva may have a prominent cleft between harpe and ampulla in some species, while in others harpe touches the ampulla, the aedeagus is narrower, with a long style and several cornuti. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 2682. 1.6: G 81 A, aly 2178.36.1: C 129 T, aly 2250.11.1: A 174 G, aly 256.7.8: T 177 A, aly 159.16.1: G 96 A; and in COI barcode: A 85 T, 232 T or C (not A), T 325 A, T 514 T, T 520 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDA0FF0FABC9FBE7.taxon	etymology	Etymology. The name is a fusion of the names of the genus and the type species of the subgenus: Ochl [odes] + [ven] ata. The name is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDA0FF0FABC9FBE7.taxon	discussion	Species included. All Old World species of Ochlodes Scudder, 1872: the type species (i. e., Hesperia venata Bremer & Grey, 1853), Pamphila bouddha Mabille, 1876, Pamphila brahma Moore, 1878, Augiades crataeis Leech, 1893, Ochlodes flavomaculata Evans, 1949, Augiades formosana Bremer & Grey, 1853, Ochlodes hasegawai Chiba & Tsukiyama, 1996, Ochlodes klapperichii Evans, 1940, Ochlodes lanta Evans, 1939, Ochlodes linga Evans, 1939, Pamphila ochracea Bremer, 1861, Ochlodes sagitta Hemming, 1934, Augiades similis Leech, 1893, Pamphila siva Moore, 1878, Hesperia subhyalina Bremer & Grey, 1853, Papilio sylvanus Esper, 1777, Pamphila thibetana Oberthür, 1886, including taxa currently treated as their subspecies and synonyms. Parent taxon. Genus Ochlodes Scudder, 1872.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDB6FBF0ABC9F865.taxon	description	http: // zoobank. org / 014 C 323 C-B 441 - 41 A 0 - A 97 F-EA 3 D 552549 D 7 /	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDB6FBF0ABC9F865.taxon	type_taxon	Type species. Hesperia yuma W. H. Edwards, 1873.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDB6FBF0ABC9F865.taxon	description	Definition. In the genomic phylogeny of Ochlodes Scudder, 1872, the second prominent clade consists of several North American species and represents a new subgenus (Fig. 131). This new subgenus differs from its relatives by a combination of the following characters: the two parts of the stigma are at least slightly offset from each other; ventral hindwing and the apex of ventral forewing are yellow to brown, sometimes with olive overscaling but not bright-green; valva is broader and lacks a prominent cleft between the harpe and ampulla, the aedeagus is medium in width or narrow, with a shorter and more robust style, terminal spike, and several larger cornuti, uncus and gnathos arms are approximately the same in length, extended and thinner than in most relatives, the juxta is broad and rounded, leaf-like, as wide as the distance between the ends of the process and the spike of the aedeagus. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 214.15.5: C 75 T, aly 1249. 14.7: G 840 A, aly 119.1.1: A 444 G, aly 1916.7.3: G 132 A, aly 2874.9.7: G 78 A; and in COI barcode: T 10 C or T 142 C, T 232 A, T 292 T, A 415 T, T 478 C, T 499 C or / and T 553 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDB6FBF0ABC9F865.taxon	etymology	Etymology. The name is a fusion of the names of the genus and the type species of the subgenus: Ochl [odes] + [y] uma. The name is a feminine noun in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD872AFFDB6FBF0ABC9F865.taxon	discussion	Species included. The type species (i. e., Hesperia yuma W. H. Edwards, 1873), Hesperia sylvanoides Boisduval, 1852, Hesperia napa W. H. Edwards, 1865, and Ochlodes sylvanoides santacruza J. Scott, 1981, including their subspecies and synonyms. Parent taxon. Genus Ochlodes Scudder, 1872.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD772A0FE2FFF14ACABFCA8.taxon	discussion	Genomic analysis reveals that Lon co Grishin, 2023 (type locality in Mexico: Guerrero) and Lon ma Grishin, 2023 (type locality in Panama) are sympatric in Monteverde, Puntarenas Province in Costa Rica (Fig. 132). They have been collected by different collectors in different years, which minimizes the chance of mislabeling. Moreover, one specimen of each species was collected there (elevation 1280 m) on September 7 – 9, 1988 by P. F. Milner (NVG- 24065 F 01, Fig. 133 b, h and NVG- 24065 E 12, Fig. 133 f, l), and also in March 1987, J. Brenner collection (NVG- 24065 E 10, Fig. 133 a, g and NVG- 23048 E 11, Fig. 133 d, j), as indicated on identical labels (within each pair) of these specimens. We use this opportunity to refine phenotypic characters for the identification of these species in the area of sympatry. Three males of each species from the Puntarenas Province are shown in (Fig. 133). We noticed five characters that may be useful for identification, pointed at by green arrows in the first specimen (Fig. 133 a, g): (1) in L. co, the dorsal hindwing discal orange patch extends deeper into cell CuA 2 - 1 A + 2 A and there is somewhat diffuse orange overscaling along and around the vein 1 A + 2 A forming a “ ray ”, which is absent in L. ma; (2) the dorsal hindwing brown margin is wider in L. co and narrower, especially between veins M 1 and M 3, in L. ma; (3) the ventral hindwing marginal area in L. co is darker than in L. ma towards the tornus, e. g., between veins M 1 and M 3; (4) the discal brown spot in the cell CuA 2 - 1 A + 2 A of the ventral hindwing is relatively smaller in L. co than in L. ma, and brown spots in this row directed towards the apex are more similar in size in L. co than in L. ma, in which the inner spot is noticeably larger than others; (5) the anal cell of the ventral hindwing is yellower in L. co than in L. ma, in which it is overscaled with brown.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD672A3FDB9FB9CAA9CF978.taxon	description	http: // zoobank. org / 4774 ED 12 - 2163 - 4 DB 9 - B 8 ED-DE 65 D 9247593 (Figs. 134 part, 135 – 136)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD672A3FDB9FB9CAA9CF978.taxon	materials_examined	Type material. Holotype: ♂ deposited in the collection of the Biodiversity Center, University of Texas at Austin, Austin, TX, USA (TMMC), illustrated in Fig. 135 (genitalia Fig. 136), bears the following five printed rectangular labels, four white: [TA. GomezFarias. 017 | 1 – 3 kSSW ElAzteca | DurdenCJ 91145 A 36], [DNA sample ID: | NVG- 22056 G 03 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24015 E 06 | c / o Nick V. Grishin], [genitalia: | NVG 241114 - 12 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Vacerra tama | Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. The holotype was collected on 25 - May- 1991 (i. e., “ 91145 ”: day 145 of 1991, A 36 is the collection event referring to this specimen in Durden’s master catalog), and 017 after “ GomezFarias ” on the first label is the code for the locality “ 1 to 3 k SSW El Azteca towards Gomez Farias. ” Paratype: 1 ♂ NVG- 24015 D 04, the same data as the holotype, but 1 – 4 km N of Gomez Farias, 350 m, 19 - Aug- 1972. Type locality. Mexico: Tamaulipas, Gomez Farias, 1 – 3 km south-southwest of El Azteca towards Gomez Farias.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD672A3FDB9FB9CAA9CF978.taxon	etymology	Etymology. The first two syllables of the Mexican state name with the type locality of this species are used as the name. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD672A3FDB9FB9CAA9CF978.taxon	distribution	Distribution. Currently known only from northeastern Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD472A4FE19F96EAA23FF36.taxon	discussion	Genomic analysis of the lectotype of Xeniades cecropterus Draudt, 1923 (type locality in Bolivia: Rio Zongo, sequenced as NVG- 18093 D 10) that is currently treated as a subspecies of Vacerra hermesia (Hewitson, 1870) (type locality in Ecuador) is genetically differentiated from it at the species level (Fig. 134); e. g., their COI barcodes differ by 2.6 % (17 bp). The two taxa also differ phenotypically as detailed by Evans (1955). Therefore, we propose that Vacerra cecropterus (Draudt, 1923), stat. rest. is a species distinct from Vacerra hermesia (Hewitson, 1870).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD372A5FD8BFEB9AA89F86B.taxon	description	http: // zoobank. org / 22 E 207 BC-AB 16 - 4 EA 6 - 9445 - 4 B 055 AB 7 D 0 DC (Figs. 134 part, 137 – 138)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD372A5FD8BFEB9AA89F86B.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 137 (genitalia Fig. 138), bears the following seven printed rectangular labels, six white: [ARGENTINA Salta | (Oran) Agua Blanca | to Angosto, Rt 19 | km 28 - 30, 650 - 750 | m 17 - ix- 89 Leg R | Eisele 89 S 3], [Vacerra hermesia | cecropterus (M) | Det Robert Eisele | ii- 10], [MGCL Accession | # 2011 - 4 | Robert Eisele], [DNA sample ID: | NVG- 23045 D 07 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24065 B 11 | c / o Nick V. Grishin], [genitalia: | NVG 241111 - 19 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Vacerra saltina | Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Paratypes: 2 ♂♂ NVG- 24065 B 12 & NVG- 24065 C 01 and 1 ♀ NVG- 23045 D 08, data as the holotype but km. 6 – 8, nr. Quebrada del Remanso, 450 m, 20 - May- 1977. Type locality. Argentina: Salta Province, Orán, km 28 – 30 of Rt. 19 Agua Blanca to Angosto, elevation 650 – 750 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD372A5FD8BFEB9AA89F86B.taxon	etymology	Etymology. The name is a fusion of Salt [a] + [Argent] ina for the type locality of this species and is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD372A5FD8BFEB9AA89F86B.taxon	distribution	Distribution. Currently known only from northern Argentina.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD172A7FDBAFFFEADA4F904.taxon	description	http: // zoobank. org / 5 BFDC 6 C 4 - DAA 3 - 446 D-B 9 DF-E 2 BA 2 D 270 F 56 (Figs. 134 part, 139 – 140)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD172A7FDBAFFFEADA4F904.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 139 (genitalia Fig. 140), bears the following seven printed (text in italics handwritten) rectangular labels, six white: [Peru: Cuzco Dept, 1375 m | Cosñipata Valley, San Pedro | 13 ° 03 ' S, 71 ° 33 ' W | November 3, 2017 | Leg: W. Dempwolf], [Vacerra hermesia | cecropterus | ♂ | Coll of: W R Dempwolf], [DNA sample ID: | NVG- 18128 C 01 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24015 G 02 | c / o Nick V. Grishin], [genitalia: | NVG 241114 - 46 | c / o Nick V. Grishin], [WRD 14,869], and one red [HOLOTYPE ♂ | Vacerra cuza | Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the abdomen prior to genitalia dissection. Type locality. Peru: Cuzco Region, Cosñipata Valley, San Pedro, elevation 1375 m, GPS − 13.05, − 71.55.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD172A7FDBAFFFEADA4F904.taxon	etymology	Etymology. The name is formed from the name of the Peruvian region with the type locality and is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD172A7FDBAFFFEADA4F904.taxon	distribution	Distribution. Currently known only from the holotype collected in Cuzco, Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD072B9FE3DF962ACF3FD8A.taxon	description	http: // zoobank. org / DEA 84675 - 0 EF 3 - 454 E-A 754 - C 848 A 69 F 0 F 63 (Figs. 141 part, 142)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD072B9FE3DF962ACF3FD8A.taxon	materials_examined	Type locality. Ecuador: Santo Domingo de los Tsáchilas Province, 12 km east of Santo Domingo de los Tsáchilas, Tinalandia Lodge, elevation 750 – 850 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD072B9FE3DF962ACF3FD8A.taxon	etymology	Etymology. The name is given for the type locality and is a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BD072B9FE3DF962ACF3FD8A.taxon	distribution	Distribution. Currently known only from the holotype collected in the western Andes of Northern Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCE72BAFE74FD19AC0EFAA0.taxon	description	http: // zoobank. org / 8 CAB 42 B 4 - 0856 - 4160 - 8 AD 1 - ECFE 68 D 36540 (Figs. 143 part, 144)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCE72BAFE74FD19AC0EFAA0.taxon	materials_examined	Type material. Holotype: ♀ deposited in the collection of the California Academy of Sciences, San Francisco, CA, USA (CAS), illustrated in Fig. 144, bears the following six rectangular labels (1 st handwritten, others printed with handwritten text shown in italics), five white: [Costa Rica, Cariblanco | Prov. Cuesta Angel | 21 Mar 81, 800 m], [Tromba | xanthura? | (Godm.) | Det. C. D. Macneill ' 98], [Collection of | C. D. MacNeill], [DNA sample ID: | NVG- 22109 F 02 | c / o Nick V. Grishin], [{QR Code} CASENT | 8568789], and one red [HOLOTYPE ♀ | Eutychide | trombella Grishin]. Type locality. Costa Rica: Heredia Province, Cuesta Angel Forest Ravine near Cariblanco, elevation 800 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCE72BAFE74FD19AC0EFAA0.taxon	etymology	Etymology. The name is given for the phenotypic resemblance of this species with Tromba Evans, 1955 (type species Tromba tromba Evans, 1955) and is an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCE72BAFE74FD19AC0EFAA0.taxon	distribution	Distribution. Currently known only from the holotype collected in northeastern Costa Rica.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCD72BCFD8AFA36AC86FB93.taxon	description	http: // zoobank. org / C 5 A 26964 - A 1 F 4 - 4601 - 98 D 1 - 1 A 3 FC 7583319 (Figs. 145 part, 146 – 147)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCD72BCFD8AFA36AC86FB93.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Texas A & M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 146 (genitalia Fig. 147), bears the following five printed (text in italics handwritten) rectangular labels, four white: [ECUADOR: Napo Prov. | Misahualli (Lodge & vic.) | 1.03381 ° S, 77.66191 ° W | VII- 5 - 10 - 2010, C. M. Riley], [DNA sample ID: | NVG- 23069 C 01 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 24015 D 06 | c / o Nick V. Grishin], [genitalia: | NVG 241114 - 01 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Talides | hispina Grishin]. The first DNA sample (sequenced) refers to the extraction from a leg and the second (stored) is from the tip of the abdomen prior to genitalia dissection. Type locality. Ecuador: Napo Province, vicinity of Misahualli Lodge, GPS − 1.03381, − 77.66191.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCD72BCFD8AFA36AC86FB93.taxon	etymology	Etymology. The name is formed from its sister species, T. hispa, which is made longer to indicate a more southern distribution of the new species. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCD72BCFD8AFA36AC86FB93.taxon	distribution	Distribution. Currently known only from the holotype collected in northern Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCD72BCFD8AFA36AC86FB93.taxon	discussion	Comment. Genitalic harpes have black stains, a sign of possible damage during or right after eclosion.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BCB72B0FEC2FB04ABF2FB59.taxon	discussion	Currently, the following eight available names are regarded as junior subjective synonyms of Goniloba clavus Herrich-Schäffer, 1869 (type locality not specified): Goniloba corope Herrich-Schäffer, 1869 (type locality not specified), Carystus orope Capronnier, 1874 (Plötz in litt.) (type locality includes at least Botafogo, Rio de Janeiro, Brazil), Hesperia crataea Hewitson, 1876 (type locality in Brazil: Bahia), Proteides cervus Möschler, 1877 (type locality in Suriname), Hesperia angulis Plötz, 1886 (type locality in Panama), Proteides ampyx Mabille, 1891 (type locality in Panama), Thracides polles Godman, 1901 (type locality in Nicaragua, Panama, and Brazil), and Perichares tripuncta Draudt, 1923 (type locality stated as South Brazil on the label of the lectotype). To gain further insights into the relationships between these taxa, we located primary type specimens of all but one of them. While P. tripuncta is already represented by the lectotype, others are syntypes, and we designate lectotypes for six names in this section and one in the next. To stabilize nomenclature and define the name Goniloba clavus Herrich-Schäffer, 1869 (type locality not specified) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a female that bears the following ten rectangular labels (1 st purple, others white; 2 nd, 3 rd, 5 th, and 7 th handwritten, others printed: [Origin.], [clavus HS.], [Col. Staudinger | K. 669], [Coll. H. — Sch.] (a large X is penciled across “ — ” on this label), [917.], [Coll. | Staudinger], [Prot. | Clavus | HS.], [Clavus | H- Sch.], [{QR Code} http: // coll. mfn-berlin. de / u / | 449 fc 1], [DNA sample ID: | NVG- 15036 D 06 | c / o Nick V. Grishin] as the lectotype of Goniloba clavus Herrich-Schäffer, 1869. The 2 nd and 7 th labels are likely written by Plötz and Staudinger, respectively. The lectotype is missing the tornal section of its left hindwing and has a deep tear from the middle of the right forewing outer margin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). Genomic sequencing places the lectotype among specimens from Southeast and South Brazil (Fig. 152), suggesting that the type locality of G. clavus is in this region. The COI barcode sequence of the lectotype, sample NVG- 15036 D 06, GenBank PV 550065, 658 base pairs, is: AACTCTATATTTTATTTTTGGTATCTGAGCAGGATTATTAGGAACTTCTTTAAGTATATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTAACAGCTCATGCCTTTATTATAATTTTCTTTATAGTTATACCTATTATAATTGGGGGATTTGGTAACTGATTAGTACCTTTAATGTTAGGAGCTCCTGATATAGCTTTTCCTCGAA TAAATAATATAAGATTCTGAATATTACCCCCATCATTAGTCTTGCTAATTTCAAGAAGAATTGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCTCTTTCTTCCAATATTGC TCATCAAGGAGCTTCGGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGTGTAAGAAATTTATTA TTTGATCAAATACCTTTATTTATTTGATCTGTAGGAATTACAGCCCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATCTTAATACTT CTTTTTTTGACCCAGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT To stabilize nomenclature and define the name Goniloba corope Herrich-Schäffer, 1869 (type locality not specified) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a male illustrated in Fig. 148 a (genitalia Fig. 149 a – d) that bears the following eight rectangular labels (1 st red, 2 nd purple, others white; 4 th and 6 th handwritten, others printed with handwritten text shown in italics): [Lectotypus], [Origin. | Corope | HS.], [Coll. H. — Sch.], [Proteid. | corope | HS.], [Coll. | Staudinger], [Corope | H-Sch.], [{QR Code} http: // coll. mfn-berlin. de / u / | 3226 a 4], [DNA sample ID: | NVG- 15035 A 04 | c / o Nick V. Grishin] as the lectotype of Goniloba corope Herrich-Schäffer, 1869. Handwriting on the 2 nd and 4 th labels matches that of Staudinger. The lectotype is missing half of its left antenna, its right wings are set farther apart from each other than the left wings, and both forewings have tears at the outer margin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). Genomic sequencing places the lectotype among specimens from Suriname (Fig. 152), suggesting that the type locality of G. corope is in the Amazonian region, likely in Suriname. To stabilize nomenclature and define the name Hesperia crataea Hewitson, 1876 (type locality in Brazil: Bahia) objectively, N. V. G. hereby designates a syntype in the BMNH collection, a male that bears the following four labels (1 st round with a red circle, others rectangular; 2 nd red, others white; 3 rd handwritten by Hewitson, 2 nd contains no text, others printed with handwritten text shown in italics): (Type) with (H | 2335) handwritten on the other side of this label, [], [crataea], [Bahia. | Hewitson Coll. | 79 — 69. | Hesperia | crataea. 1.] as the lectotype of Hesperia crataea Hewitson, 1876. The lectotype is missing its abdomen, has some damage along the outer margin of the right hindwing towards the tornus, and is pinned on a short pin inserted into a holder pinned on a regular pin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). To stabilize nomenclature and define the name Proteides cervus Möschler, 1877 (type locality in Suriname) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a female that bears the following eight rectangular labels (1 st purple, 2 nd and 3 rd green, others white; 2 nd, 3 rd, and 5 th handwritten, others printed): [Origin.], [Surinam. | Bgdl. | L. 74.], | [Type. | Verhdlg. d. zool. bot. | Gsllschft. Wien. | XXVI. T. IV. 17. p. 333.], [Coll. Möschl.], [Cervus | Möschl], [Coll. | Staudinger], [{QR Code} http: // coll. mfn-berlin. de / u / | 44 a 014], [DNA sample ID: | NVG- 15036 F 09 | c / o Nick V. Grishin] as the lectotype of Proteides cervus Möschler, 1877. The lectotype is missing its antennae, the end of the abdomen, and the apex of the right hindwing, which was repaired and the middle section glued on, leaving a gap in the middle. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The type locality of P. cervus (as given on the label) is Suriname: Brokopondo District, Berg en Dal (abbreviated as “ Bgdl. ”). The COI barcode sequence of the lectotype, sample NVG- 15036 F 09, GenBank PV 550066, 658 base pairs, is: AACTTTATATTTTATTTTTGGTATATGAGCAGGATTGTTAGGAACTTCATTAAGTATATTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTCATAGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTATCCCCCTCTTTCCTCCAATATCGC TCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACAATCATTAATATACGAGTAAGAAACTTATCC TTTGATCAAATACCATTATTTATTTGATCAGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAATCTTAATACTT CTTTTTTCGATCCAGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT To stabilize nomenclature and define the name Proteides ampyx Mabille, 1891 (type locality in Panama: Chiriquí) objectively, N. V. G. hereby designates a syntype in the MFNB collection, a male that bears the following eight rectangular labels (1 st purple, others white; 2 nd, 3 rd, 4 th, and 6 th handwritten, others printed): [Origin.], [Chiriqui | Tr.], [Pr. Ampyx | Mb], [Proteid. | Ampyx | Mab.], [Coll. | Staudinger], [Ampÿx | Mab.], [{QR Code} http: // coll. mfn-berlin. de / u / | 449 fc 0], [DNA sample ID: | NVG- 15036 D 05 | c / o Nick V. Grishin] as the lectotype of Proteides ampyx Mabille, 1891. According to its 2 nd label, the lectotype was collected in Panama: Chiriquí by Troetsch. The 3 rd and the 4 th labels are likely written by Mabille and Staudinger, respectively. The lectotype has scales rubbed off at the base of the right hindwing beneath, which was re-attached, and two angular bends in its left antenna. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15036 D 05, GenBank PV 550067, 658 base pairs, is: AACTTTATATTTTATTTTCGGTATATGAGCAGGATTATTAGGAACTTCCTTAAGTATATTAATTCGAACAGAATTAGGAAATCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCCCTTTCATCCAATATTGC TCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAGAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGACCCAGCTGGTGGAGGAGATCCTATTTTATACCAACATTTATTT To stabilize nomenclature, to define the name Thracides polles Godman, 1901 (type locality in Nicaragua, Panama, and Brazil) objectively, and narrow down the type locality, N. V. G. hereby designates a syntype in the MFNB collection, a female that according to its label was figured on the plate 105 in the original publication (Godman 1901) and bears the following nine rectangular labels (1 st purple, others white; 4 th handwritten, others printed): [Origin.], [Chiriqui], [811.], [P. b. 159: 12.], [Coll. | Staudinger], [Sp. figured], [B. C. A. Lep. Rhop. | Thracides | polles, | Godm.], [{QR Code} http: // coll. mfn-berlin. de / u / | 440 fc 9], [DNA sample ID: | NVG- 15036 E 01 | c / o Nick V. Grishin] as the lectotype of Thracides polles Godman, 1901. The lectotype is missing the left antenna and has two small tears at the outer margins of the left hindwing along CuA 2 vein and the right forewing in the cell CuA 1 - CuA 2, but otherwise is a specimen in excellent condition. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). As a result of the lectotype designation, the type locality of T. polles becomes Panama: Chiriquí. The COI barcode sequence of the lectotype, sample NVG- 15036 E 01, GenBank PV 550068, 658 base pairs, is: AACTTTATATTTTATTTTTGGTGTATGAGCAGGATTATTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCCCTTTCATCCAATATTGC CCACCAAGGGGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAAAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGCGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC772B2FF2AFB43AB7EFC58.taxon	discussion	We translate from French the entire original description of Carystus orope Capronnier, 1874 (Plötz in litt.) as: “ 156. C. Orope, Plötz. Herrich-Schäffer gave to this species the name of Gon. Corope, and to another, the name of Cobalus Corope. Mr. Plötz finds that two similar names in the same family are a cause of confusion, and, to avoid it, he suggests for the species in question the name of Orope. Sept., 18. Botafogo ” (Capronnier 1874). The two species mentioned in the description are Goniloba corope Herrich-Schäffer, 1869 (type locality likely in the Amazonian region, lectotype sequenced as NVG- 15035 A 04), currently in the genus Damas Godman, 1901 (type species Goniloba clavus Herrich-Schäffer, 1869), and Cobalus corope Herrich-Schäffer, 1869 (type locality likely in Southeast or South Brazil, syntypes sequenced as NVG- 15035 A 02 and NVG- 15035 A 03), currently in the genus Tigasis Godman, 1900 (type species Tigasis zalates Godman, 1900). We argue that the original description contains a lapsus and Capronnier should have written “ Herrich-Schäffer gave to this species the name of Cobalus Corope, and to another, the name of Gon. Corope, ” demonstrating that the two identical species epithets are confusing. First, the type series of Carystus orope includes not only the specimen (s) collected by van Volxem on September 18, 1872, in Botafogo, Rio de Janeiro, Brazil, and listed explicitly by Capronnier (1874), but also specimens that Plötz considered to be orope, because Plötz is explicitly mentioned in the description, and the name is attributed to him (Capronnier 1874). Second, in the unpublished manuscript by Plötz (in ZSMC) dated 1876 that served as a draft of his publications, he refers to “ Orope m. ”, where “ m. ” is for “ mihi ” (“ of me ” in Latin), appended to the species name to indicate authorship of the description, in agreement with Capronnier (1874) who attributed the name orope to Plötz. Both the manuscript and the published version (Plötz 1882 a) list the name “ Corope HS. ” (“ HS. ” is for Herrich-Schäffer) under Orope, suggesting that Orope and at least part of Herrich-Schäffer’s Corope type series refer to the same taxon and referencing it as “ Prodr. 1869. 80. 37. ” (in the manuscript) and “ Prodr. 1869, p. 80 n. 37. ♀ ” in the publication. The number 37 refers to Cobalus corope (number within Cobalus), and Goniloba corope is the number 48 (number within Goniloba) (Herrich-Schäffer 1869). Page number 80 refers to the page with “ 37. [Cobalus] corope HS ” in “ separate reprints ” (“ Separatabdrücke ”) bound as a book (Herrich-Schäffer 1864 – 1869). Third, Godman’s copy of the original drawing t [afel]. 533 by Plötz showing his “ Hesperia orope ” reproduced here as Fig. 150 b agrees with his and Herrich-Schäffer’s descriptions of Cobalus corope and not of Goniloba corope. Fourth, in his Catalogue, Kirby (1877) expressed the same opinion that “ P. Orope, Plötz, (Carystus O.) Ann. E. Belg. XVII. p. 34. (1874.) ” (note the reference to Capronnier (1874 )) was “ Cobalus (nec Goniloba) Corope ”. Fifth, Goniloba corope is an Amazonian species (see the section above) not known from Rio de Janeiro. In contrast, Cobalus corope is distributed in Southeast and South Brazil, where van Volxem collected at least one of the Carystus orope syntypes. In MFNB, we found and sequenced two syntypes of Cobalus corope, a male (NVG- 15035 A 02) and a female (NVG- 15035 A 03). The female (Fig. 150 a) agrees well with Plötz’s key that specifically mentions a female (possibly meaning that the name orope was proposed for a female of Herrich-Schäffer’s Cobalus corope) and the drawing (Fig. 150 b) of “ Hesperia orope ” and, therefore, taking into account the discussion above, is a syntype of Carystus orope Capronnier. Moreover, one of the labels of this syntype is “ C. orope Pl. ”, likely written by Mabille. To stabilize nomenclature and define the name C. orope objectively, N. V. G. hereby designates this female syntype in MFNB shown in Fig. 150 a that bears the following twelve labels (1 st purple, 10 th red, others white; 2 nd, 4 th – 8 th, and 10 th handwritten, others printed with handwritten text shown in italics): [Origin. | corope], [corope | ♀], [Coll. H. — Sch |], [969.], [C. orope Pl.], [51: 10 oder 11], [„ Malaisie “ | (nach Mabille)], [Pa. Orope | Plötz | Corope HS. prop.], [Coll. | Staudinger], [Paralectotypus], [{QR Code} http: // coll. mfn-berlin. de / u / | 3226 a 2], [DNA sample ID: | NVG- 15035 A 03 | c / o Nick V. Grishin] as the lectotype of Carystus orope Capronnier, 1874 (Plötz in litt.). The 2 nd label might have been written by Herrich-Schäffer, the 7 th and 8 th labels and the word “ corope ” on the 1 st label are in Staudinger’s handwriting, and the 5 th label is in Mabille’s handwriting. The 6 th label “ 51: 10 oder 11. ” gives the numbers for “ P [renes]. orope, Plötz ” (51: 10) and “ P [renes]. corope, Herrich-Schäffer, Prodr. Syst. Lep. p. 76 ” (51: 11) in Mabille’s catalog (1903), meaning that this specimen was identified as P. orope or (“ oder ” in German) P. corope by a curator of the MFNB collection. The lectotype of Carystus orope is simultaneously a syntype of Cobalus corope Herrich-Schäffer, 1869. The lectotype is missing both antennae, and its left wings are separated from each other by a wider gap than the right wings. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). Genomic comparison suggests that the type locality of C. orope (and Tigasis corope) is in Southeast or South Brazil. The COI barcode sequence of the lectotype, sample NVG- 15035 A 03, GenBank PV 550064, 658 base pairs, is: AACTCTATATTTTATTTTTGGAATTTGAGCAGGTATACTAGGAACTTCCTTAAGTTTATTAATTCGTACAGAATTAGGAAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGTGCCCCAGATATAGCTTTCCCCCGAA TAAATAACATAAGTTTTTGAATACTACCCCCCTCTTTAATATTATTAATTTCTAGTAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTATCCCCCTCTTTCTTCTAATATTGC TCACCAAGGTTCATCTGTTGATTTAGCTATCTTTTCTCTTCACTTAGCAGGTATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAAATACCTTTATTTGTATGATCAGTAGGAATTACTGCATTATTATTACTTTTATCTTTACCTGTACTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATTTAAATACTT CCTTTTTTGACCCCGCTGGAGGAGGAGATCCTATTTTATACCAACATTTATTT Both phenotypic assessment and genomic analysis place Carystus orope Capronnier, 1874 (Plötz in litt.) as a junior subjective synonym of Tigasis corope (Herrich-Schäffer, 1869), not of Damas corope (Herrich-Schäffer, 1869) (Fig. 151).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC572B3FE16F9A3ABF2F85F.taxon	discussion	Hesperia angulis Plötz, 1886 was described from an unstated number of specimens from Panama collected by Ribbe (Plötz 1886). Our literal translation of the description from German is: “ Forewing with a yellow-dusted long hyaline spot on the hind margin of the discal cell, an angle-shaped spot in cell 2, a square spot slightly towards the margin in cell 3, a dot in cell 6, and in cell 1 a dust spot, which is much more extensive on the underside. Otherwise, everything is blackish-brown. The forewing is towards the apex, and the hindwing towards tornus stretched. The antenna is almost 2 / 3 as long as the forewing. (Ribbe.) 24 mm. Panama. ” Searching for syntypes, we found a specimen in the ZSMC bearing a label “ Hesperia Angulis Plötz ” in Plötz’s handwriting in addition to the “ Lectotypus ” label. The lectotype designation has not been published. This specimen is also labeled as being from “ Am. m. ” (i. e., America Meridionalis, South America, not Panama) and does not have a label connecting it to Carl Ribbe, who collected the type (s) according to the original description. Moreover, this specimen does not fully agree with the original description of H. angulis: the hyaline spot in the forewing cell 2 (CuA 1 - CuA 2) is crescent-shaped rather than angle-shaped, the latter is characteristic of specimens from Panama, thus supporting the type locality given in the original description. Therefore, we conclude that this specimen is not a syntype, but likely a specimen that was identified by Plötz as H. angulis, possibly after the original description. Genomic sequencing of this specimen (NVG- 18056 H 08) places it among specimens collected north of Panama, mainly in Guatemala and southern Mexico, further supporting the hypothesis that it is not a syntype. Next, we searched for syntypes of H. angulis in other collections (see Acknowledgments section for their list), most carefully in the MFNB, where many specimens collected by Ribbe are preserved as part of the Staudinger collection, and also in the ZSMC. Despite inspecting every Damas specimen among the entire Hesperiidae holdings, N. V. G. failed to find a specimen from Panama collected by Ribbe and agreeing with the original description of H. angulis. Therefore, we believe that syntypes of this taxon were lost. Not finding syntypes, we proceeded with the neotype designation because there is an exceptional need to clarify the taxonomic identity of H. angulis and define it objectively due to new species present in the complex, multiple synonymic names, likely incorrect type localities for some taxa, and a non-syntypic specimen, possibly from Mexico or Guatemala, identified by Plötz as H. angulis that is not conspecific with specimens collected in Panama. To address all these problems, hereby, N. V. G. designates the specimen in USNM illustrated in Fig. 148 b (DNA sample NVG- 23122 H 05) as the neotype of Hesperia angulis Plötz, 1886. This neotype satisfies all requirements set forth by the ICZN Article 75.3, namely: 75.3.1. It is designated to clarify the taxonomic identity of Hesperia angulis Plötz, 1886, which is necessary because additional species are present among its close relatives; 75.3.2. The characters to differentiate this taxon from others were given in the original description (Plötz 1886) that was translated above. We regard them as follows, adding male genitalic characters: an elongated hyaline spot along the lower side of the discal cell on the forewing, an angle-shaped hyaline spot in the forewing cell CuA 1 - CuA 2, a square hyaline spot near the base of forewing cell M 3 - CuA 1, a dot-shaped hyaline spot in the forewing cell R 5 - M 1, a diffuse spot of pale scales near the middle of the forewing cell CuA 2 - 1 A + 2 A near the 1 A + 2 A vein, this spot is much more prominent on the ventral side, otherwise mostly dark brown; the posteriorly directed spike-like process of the tegumen is not reaching the end of the uncus, the harpe is terminally rounded, with a longer dorsoposterior margin that is finely serrated and with a narrower tooth by the ampulla that is directed anterodorsad, uncus arms are slightly divergent, shorter than in the closest relatives; 75.3.3. The neotype specimen is a male bearing two rectangular white labels (1 st handwritten, 2 nd printed): [Bayano | Pma. Panama | 26 05 74 | G B Small], [DNA sample ID: | NVG- 23122 H 05 | c / o Nick V. Grishin], and illustrated in Fig. 148 b; the neotype is a specimen in excellent condition, has its head tilted to the right, proboscis expanded anteriad, and some scales rubbed off at the bases of both forewings and near the right forewing apex above; 75.3.4. As detailed above, we carefully searched for syntypes of H. angulis in the MFNB and other collections. We failed to find the syntypes among Hesperiidae holdings in these collections and, therefore, believe that they were lost; 75.3.5. The neotype closely agrees with the original description of H. angulis in all characters, as evidenced by comparing the neotype illustrated in Fig. 148 b with the characters for this taxon given in the original description (Plötz 1886) and listed above (75.3.2.); 75.3.6. The neotype is from Panama: Panama, and the original type locality was in Panama, which may be narrowed down to central Panama, in contrast to Chiriquí, as usually stated in the labels of specimens collected by Ribbe, who collected the type series; 75.3.7. The neotype is in the National Museum of Natural History, Washington, DC, USA (USNM). The COI barcode sequence of H. angulis neotype, sample NVG- 23122 H 05, GenBank PV 550069, 658 base pairs, is: AACTTTATATTTTATTTTTGGTGTATGAGCAGGATTATTAGGAACTTCCTTAAGTATACTAATTCGAACAGAATTAGGAAATCCTGGATCTTTAATTGGAGACGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCTCGAA TAAATAATATAAGATTTTGGATACTACCCCCATCCTTAATCTTATTAATTTCAAGAAGAATCGTAGAAACTGGAGCAGGAACTGGTTGAACTGTTTACCCCCCCCTTTCATCCAATATTGC CCACCAAGGAGCTTCAGTAGATTTAGCTATTTTTTCTCTACATTTAGCAGGAATTTCTTCTATTTTAGGAGCAATCAATTTTATTACCACAATTATTAATATACGAGTAAAAAATTTATCC TTTGATCAAATACCATTATTTATTTGATCCGTAGGAATTACAGCTCTCTTATTACTTTTATCTTTACCAGTTTTAGCAGGAGCTATTACTATATTACTTACTGATCGAAACCTTAATACTT CTTTTTTTGATCCAGCTGGCGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC372B5FE7EFAE3AA9CF98A.taxon	discussion	Having achieved an objective definition of all names in the Damas clavus (Herrich-Schäffer, 1869) complex and a better understanding of their type localities, we now proceed with the species delimitation. Genomic analysis of sequenced specimens that included primary types of nearly all available names (except Hesperia crataea Hewitson, 1876 (type locality in Brazil: Bahia) and Damas woldi Shuey, 2024 (type locality in French Guiana )) reveals that the complex consists of several species (Fig. 152). Damas clavus (Herrich-Schäffer, 1869) (type locality in Southeast or South Brazil, lectotype sequenced as NVG- 15036 D 06) is most distantly related to others (Fig. 152 cyan). Sequenced specimens from Bahia, Brazil, where the lectotype of Hesperia crataea Hewitson, 1876 was collected, are placed within this species. Therefore, we maintain the synonymy of Hesperia crataea Hewitson, 1876 with D. clavus. However, all other taxa currently regarded as synonyms of D. clavus are either distinct species or synonyms of each other. Guided by the name priority, Goniloba corope Herrich-Schäffer, 1869 (type locality in the Amazonian region, lectotype sequenced as NVG- 15035 A 04), Proteides cervus Möschler, 1877 (type locality in Suriname, lectotype sequenced as NVG- 15036 F 09), and Hesperia angulis Plötz, 1886 (type locality in Panama: Panama, neotype sequenced as NVG- 23122 H 05) are genetically differentiated from D. clavus and each other at the species level (Fig. 152), e. g., COI barcodes of the closest species pair P. cervus and H. angulis differ by 3.5 % (23 bp). Therefore, we propose that Damas corope (Herrich-Schäffer, 1869), stat. rest., Damas cervus (Möschler, 1877), stat. rest., and Damas angulis (Plötz, 1886), stat. rest. are species-level taxa distinct from Damas clavus (Herrich-Schäffer, 1869). We find that the lectotype of D. corope belongs to a clade with a wide range in the Amazonian region from Guyana and Suriname to Rondônia in Brazil and Madre de Dios in Peru (Fig. 152 blue). To show identification of D. corope and differences between species, we illustrate segments of the mitochondrial genome alignment of several Damas taxa, including their lectotypes (Fig. 153, the lectotype of D. corope is labeled in red font). Although we have not yet sequenced the holotype of Damas woldi and specimens from French Guiana, we hypothesize that they may belong to this clade due to phenotypic similarity and distribution. Therefore, we tentatively regard Damas woldi Shuey, 2024, syn. nov. as a junior subjective synonym of Damas corope (Herrich-Schäffer, 1869), stat. rest. Specimens from Chiriquí, Panama, form a tight subclade within D. angulis in the nuclear genome tree and are genetically differentiated from others to warrant at least a subspecies status (Fig. 152 purple clade); e. g., their COI barcodes differ by 1.5 % (10 bp). Therefore, we propose that Proteides ampyx Mabille, 1891 (type locality in Panama: Chiriquí, lectotype sequenced as NVG- 15036 D 05) is a subspecies of Damas angulis (Plötz, 1886), stat. rest.: Damas angulis ampyx (Mabille, 1891), stat. nov. The lectotype of Thracides polles Godman, 1901 (type locality in Panama: Chiriquí, sequenced as NVG- 15036 E 01) and, to our surprise, the lectotype of Perichares tripuncta Draudt, 1923 (type locality stated as South Brazil on the label, sequenced as NVG- 18093 C 07) group closely with the lectotype of D. angulis ampyx, and therefore, we regard the two former taxa as junior subjective synonyms of the latter, a new placement of synonyms. This result implies that the lectotype of P. tripuncta has been mislabeled and was most likely collected in Chiriquí, Panama. Note the angle-shaped hyaline spot in the forewing cell CuA 1 - CuA 2 and a long discal cell hyaline dash characteristic of Panamanian specimens in the lectotype of P. tripuncta: images of this specimen photographed by E. Brockmann are shown on the Butterflies of America website (Warren et al. 2024). Furthermore, we find three species-level clades that do not have available names associated with them and, therefore, represent new species, which are described next.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC272B6FD9CF910A8DBF9B6.taxon	description	http: // zoobank. org / 3 E 984 A 36 - 0510 - 48 F 1 - BEE 1 - 4 FB 2 E 09 D 34 F 4 (Figs. 148 c, 149 h – i, 152 part, 153 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC272B6FD9CF910A8DBF9B6.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Senckenberg Natural History Museum, Frankfurt, Germany (SMF), illustrated in Fig. 148 c, bears the following five printed (text in italics handwritten) rectangular labels (1 st grayish-green, 2 nd and last red, others white): [Honduras | San Pedro Sula | ex coll. Fruhstorfer], [Para lec- | to typus], [Paralectotypus | Perichares | tripuncta | Draudt, 1923 | O Mielke det 19 79], [DNA sample ID: | NVG- 18093 E 04 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Damas honduras | Grishin]. The holotype is also a paralectotype of Perichares tripuncta Draudt, 1923 (type locality in Panama: Chiriquí as deduced by the genomic sequencing of the lectotype NVG- 18093 C 07, not S. Brazil). Images of this specimen photographed by E. Brockmann are shown on the Butterflies of America website (Warren et al. 2024). Paratypes: 9 ♂♂ and 4 ♀♀: Mexico, T. Escalante leg. [MGCL]: 1 ♂ NVG- 24099 D 02 Chiapas, Santa Rosa Comitán, Sep- 1965; 2 ♂♂ Oaxaca, Chimalapa: NVG- 24099 D 01 Sep- 1963 and NVG- 24099 C 11 Sep- 1965; and 1 ♂ NVG- 24099 C 12 Veracruz, Catemaco, Sep- 1956; Guatemala: Petén, Tikal: 1 ♂ NVG- 22057 A 08 and 1 ♀ NVG- 22057 A 05 7 - Jan- 1990, C. J. Durden leg. [TMMC] and 1 ♂ NVG- 24099 C 02, UF FLMNH MGCL 104891 11 - Sep- 1993, D. L. Lindsley leg. [MGCL] and Cayuga, old, Schaus & Barns collection [USNM]: 1 ♂ NVG- 23123 A 10, genitalia NVG 240817 - 69 (Fig. 149 h, i) and 1 ♀ NVG- 23123 A 11; 1 ♀ NVG- 24099 C 01 Belize, Orange Walk District, Gallon Jug, Jan- 2006, J. Benner collection [MGCL]; Honduras San Pedro Sula, old [MFNB]: 1 ♂ NVG- 24029 E 03 Coll. Thieme and 1 ♀ NVG- 23075 H 02; and 1 ♂ NVG- 18056 H 08 " South America " [likely Guatemala], old [ZSMC]. Type locality. Honduras: San Pedro Sula.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC272B6FD9CF910A8DBF9B6.taxon	etymology	Etymology. The name rhymes with the genus name and is given for the country with the type locality. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC272B6FD9CF910A8DBF9B6.taxon	distribution	Distribution. From southern Mexico to Honduras.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC272B6FD9CF910A8DBF9B6.taxon	discussion	Comment. Note that the genitalia of Damas are sclerotized more weakly than most other Hesperiidae and thus appear paler (Fig. 149).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC172B7FDBBF93FAD96FB19.taxon	description	http: // zoobank. org / F 274 D 8 A 9 - 4 E 44 - 4704 - 84 BF-C 1 AAF 9939812 (Figs. 148 d, 149 j – k, 152 part, 153 part)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC172B7FDBBF93FAD96FB19.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 148 d, bears the following four printed rectangular labels, three white: [Iquitos | Amazon. Sup. | 1892. Michael], [Coll. Staudinger], [DNA sample ID: | NVG- 23078 E 10 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Damas kenos | Grishin]. The holotype was collected in 1892 by Otto Michael. Paratypes: 4 ♂♂ and 1 ♀: Peru, Madre de Dios, Tambopata Reserve: 1 ♂ NVG- 23123 B 06 Rio la Torre, 1 - Oct- 1986. S. S. Nicolay leg., genitalia NVG 240817 - 70 (Fig. 149 j, k) [USNM] and 1 ♀ NVG- 24099 C 08 60 km S of Puerto Maldonado, Rio Tambopata, 25 - Oct- 1999, D. & J. Lindsley leg. [MGCL] and Brazil, Pará: 1 ♂ NVG- 24099 D 08 Santarem, ex coll. Le Moult; 1 ♂ NVG- 21118 A 09 1886, Donckier leg. [MFNB] and 1 ♂ NVG- 18056 H 09 " Amaz. Inf. " P. Hahnel leg. [ZSMC]. The last specimen is labeled as a “ paratype ” of Proteides ampyx Mabille, 1891 (type locality in Panama: Chiriquí). However, it is not from the type locality and, therefore, is not a syntype of that taxon. Type locality. Peru: Loreto Region, Iquitos.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC172B7FDBBF93FAD96FB19.taxon	etymology	Etymology. In Greek, κενός (kenos) means empty or void and is given for the lack of a pale spot in the discal cell of the forewing in this species. The name is treated as an indeclinable adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC172B7FDBBF93FAD96FB19.taxon	distribution	Distribution. The Amazonian region from north-eastern Peru to the lower Amazon.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC072C8FD93FA80ACE1FA44.taxon	description	http: // zoobank. org / 008 D 4653 - DE 83 - 4 E 6 D-B 40 A- 050 D 3 C 1 C 8 F 2 A (Figs. 149 l – m, 152 part, 154)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC072C8FD93FA80ACE1FA44.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 154, bears the following three printed (text in italics handwritten) rectangular labels, two white: [PERU Madre De Dios | Rio La Torre 300 m | Tambopata Res. | 29 Sept. ' 86 | S. S. Nicolay], [DNA sample ID: | NVG- 23123 B 07 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Damas lavandas | Grishin]. Paratypes: 2 ♂♂ from Peru, Madre de Dios: 1 ♂ NVG- 23123 B 05 30 km SW of Puerto Maldonado, 300 m, 17 - Oct- 1983, S. S. Nicolay leg. [USNM] and 1 ♂ NVG- 24099 C 06 (leg DNA extraction, sequenced), NVG- 24127 F 09 (abdomen DNA extraction and dissection) 60 km S of Puerto Maldonado, Rio Tambopata, 25 - Oct- 1999, D. & J. Lindsley leg., genitalia NVG 250517 - 06 (Fig. 149 l, m) [MGCL]. Type locality. Peru: Madre de Dios Region, Tambopata National Reserve, Rio La Torre, elevation 300 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC072C8FD93FA80ACE1FA44.taxon	etymology	Etymology. In Spanish, lavanda means lavender. The name rhymes with the genus name and is given for the purplish sheen on the ventral side of this species. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC072C8FD93FA80ACE1FA44.taxon	distribution	Distribution. Currently known only from the Tambopata National Reserve in southeastern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
4D7E87DA4BC072C8FD93FA80ACE1FA44.taxon	discussion	Comment. This species is sympatric with Damas kenos sp. n., in the Tambopata National Reserve, Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2025): Advancing butterfly systematics through genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (5): 1-201, DOI: 10.5281/zenodo.16642576
