identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
C3C7C641FE2D52C9AC85EECBA36E96AF.text	C3C7C641FE2D52C9AC85EECBA36E96AF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aldinomyces tarquinii Tedersoo 2025	<div><p>Aldinomyces tarquinii Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Aldinomyces based on ITS 2 (positions 225–244 taaagaagatttcttcttta; two mismatches allowed) and LSU D 2 (positions 709–728 gcggctggacagctgtgcaa; one mismatch allowed) as indicated in Fig. 50. Intraspecific variation up to 1.1 % in ITS 2 and up to 0.4 % in LSU. Interspecific distance at least 3.9 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 002655 (holotype); eDNA sequence EUK 1205365 = OZ 253811 (legitype); eDNA sample TUE 102655 (nucleotype); GSMc plot S 1183, mixed forest in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=11.4964&amp;materialsCitation.latitude=46.4072" title="Search Plazi for locations around (long 11.4964/lat 46.4072)">Aldino</a>, Italy, 46.4072°N, 11.4964°E .</p><p>Description.</p><p>Other sequences: EUK 1205356 (type locality); EUK 1124394 (GSMc plot G 5912, temperate grassland soil in Rahinge, Estonia, 58.3804°N, 26.6289°E); EUK 0320467 (FunAqua sediment sample W 0315 s in Cottonwood Lake, ND, USA, 47.1, – 99.09); EUK 0529885 (GSMc plot G 2838 X; tundra soil in Kvaenangsfjellet, Norway, 69.8972°N, 21.5778°E); and GlobalFungi accessions fa 0 dd 51 fb 77 b 34 cf 5 b 5659 d 5 f 4 d 674 c 1 (forest soil in Yunnan, China, 27.12°N, 100.17°E); ea 737611 f 71505778 a 4409 d 28 eec 463 d ( woodland soil in MT, USA, 45.3982, –110.704); and 5363 d 0 a 2 c 4815 da 4 d 7 fb 36 f 7 f 94 d 6 c 6 e (forest soil in Austria, 47.36°N, 15.05°E).</p><p>Etymology.</p><p>Aldino (Italian) refers to the type locality, and Tarquin (English) refers to Tarquin Netherway, who collected the material from the type locality.</p><p>Notes.</p><p>Found in three soil samples and one sediment sample in the Northern Hemisphere. GlobalFungi records (n = 12) confirm the distribution in soils of the Holarctic realm.</p></div>	https://treatment.plazi.org/id/C3C7C641FE2D52C9AC85EECBA36E96AF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
C00F1B46B22C5C6FB3C1C68E3D941521.text	C00F1B46B22C5C6FB3C1C68E3D941521.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aldinomyces Tedersoo 2025	<div><p>Aldinomyces Tedersoo gen. nov.</p><p>Type species.</p><p>Aldinomyces tarquinii Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 139–158 gcggatttcgaaagatttct in type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycetaceae, covering sequences EUK 1205365, EUK 1124394, and EUK 0529911 (Figs 1, 49).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises about four potential species represented by sequences EUK 0483667 (forest soil in Argentina), EUK 0138900 (forest soil in Norway), and EUK 0529911 ( woodland soil in Estonia).</p></div>	https://treatment.plazi.org/id/C00F1B46B22C5C6FB3C1C68E3D941521	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
FDED5FD6E64C55A6BD6C968396FA849E.text	FDED5FD6E64C55A6BD6C968396FA849E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aldinomycetaceae Tedersoo 2025	<div><p>Aldinomycetaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Aldinomyces Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1686–1695 tagcgatagg in S. cerevisiae; no mismatch allowed) and ITS 2 (positions 125–137 gcaacatartaat in type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycetales, covering sequences EUK 1205365, EUK 1124394, EUK 0529911, and EUK 0529884 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Aldinomyces (gen. nov.) and potentially genus-level taxa represented by sequences JX 898614 (cave debris in NY, USA) and EUK 0529884 (grassland soil in Estonia).</p></div>	https://treatment.plazi.org/id/FDED5FD6E64C55A6BD6C968396FA849E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
0B22B2F5324D5725B3E5210289CBDDEB.text	0B22B2F5324D5725B3E5210289CBDDEB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aldinomycetales Tedersoo 2025	<div><p>Aldinomycetales Tedersoo ord. nov.</p><p>Type family.</p><p>Aldinomycetaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 732–746 gattcaggaccttca in S. cerevisiae; no mismatch allowed), SSU V 7 (positions 1346–1355 gttgttggtc in S. cerevisiae; no mismatch allowed), and LSU D 3 (positions 912–926 in the type species and 771–785 in S. cerevisiae: ggttttgagaaaaag; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycetes, covering sequences EUK 0320466, EUK 0529888, EUK 1205365, EUK 1124394, EUK 0529884, EUK 1111390, EUK 0529911, and EUK 0320468 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Aldinomycetaceae (fam. nov.) and other potentially family-level groups represented by sequences EUK 1111390 (forest soil in Sweden), EUK 0320466 (river sediment in Spain), EUK 0529888 (orchard soil in Estonia), and EUK 0320468 (river sediment in Spain).</p></div>	https://treatment.plazi.org/id/0B22B2F5324D5725B3E5210289CBDDEB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
56AEDF1491A859789F6EA2E9A32479A3.text	56AEDF1491A859789F6EA2E9A32479A3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aldinomycetes Tedersoo	<div><p>Aldinomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Aldinomycetales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 732–746 gattcaggaccttca in S. cerevisiae; no mismatch allowed), SSU V 7 (positions 1346–1355 gttgttggtc in S. cerevisiae; no mismatch allowed), and LSU D 3 (positions 912–926 in the type species and 771–785 in S. cerevisiae: ggttttgagaaaaag; one mismatch allowed). Forms a monophyletic, least inclusive clade in Aldinomycota, covering sequences EUK 0320466, EUK 0529888, EUK 1205365, EUK 1124394, EUK 0529884, EUK 1111390, EUK 0529911, and EUK 0320468 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently harbors Aldinomycetales (ord. nov.).</p></div>	https://treatment.plazi.org/id/56AEDF1491A859789F6EA2E9A32479A3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
752126C0938B50C59E795234344031E8.text	752126C0938B50C59E795234344031E8.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aldinomycota Tedersoo 2025	<div><p>Aldinomycota Tedersoo phyl. nov.</p><p>Type class.</p><p>Aldinomycetes Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 732–746 gattcaggaccttca in S. cerevisiae; no mismatch allowed), SSU V 7 (positions 1346–1355 gttgttggtc in S. cerevisiae; no mismatch allowed), and LSU D 3 (positions 912–926 in the type species and 771–785 in S. cerevisiae: ggttttgagaaaaag; one mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 0320466, EUK 0529888, EUK 1205365, EUK 1124394, EUK 0529884, EUK 1111390, EUK 0529911, and EUK 0320468 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 45 in EUKARYOME v 1.9. Comprises potentially 65–70 species. Currently harbors Aldinomycetes (class. nov.). Detected in soil (98.2 % out of 113 records) and sediments (1.8 %) in tundra to wet tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/752126C0938B50C59E795234344031E8	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
FBFF4A6C9250540F9707D6CD24A575AC.text	FBFF4A6C9250540F9707D6CD24A575AC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Algovoracaceae Tedersoo & Y. Ding 2025	<div><p>Algovoracaceae Tedersoo &amp; Y. Ding fam. nov.</p><p>Type genus.</p><p>Algovorax Tedersoo &amp; Y. Ding .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8 S-ITS 2 (positions starting from 150 in type species and 154 in S. cerevisiae gtgaaacctcctcaa; one mismatch allowed) and from other groups of Monoblepharomycota in SSU V 7 (positions 1485–1494 in S. cerevisiae acgagtatat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Algovoracales, covering sequences MF 163176, OQ 702880, EF 024210, and OQ 687303 (Fig. 1).</p><p>Notes.</p><p>Includes the genus Algovorax (gen. nov.).</p></div>	https://treatment.plazi.org/id/FBFF4A6C9250540F9707D6CD24A575AC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
6A8FB21D8A08546895031C486E4E738F.text	6A8FB21D8A08546895031C486E4E738F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Algovoracales Tedersoo & Y. Ding 2025	<div><p>Algovoracales Tedersoo &amp; Y. Ding ord. nov.</p><p>Type family.</p><p>Algovoracaceae Tedersoo &amp; Y. Ding .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8 S-ITS 2 (positions starting from 150 in type species and 154 in S. cerevisiae gtgaaacctcctcaa; one mismatch allowed) and from other groups of Monoblepharomycota in SSU V 7 (positions 1485–1494 in S. cerevisiae acgagtatat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Algovoracomycetes, covering sequences MF 163176, OQ 702880, EF 024210, and OQ 687303 (Fig. 1).</p><p>Notes.</p><p>Currently includes Algovoracaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/6A8FB21D8A08546895031C486E4E738F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
1EB976B9745450A9BFEAEF43903308C3.text	1EB976B9745450A9BFEAEF43903308C3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Algovoracomycetes Tedersoo & Y. Ding 2025	<div><p>Algovoracomycetes Tedersoo &amp; Y. Ding class. nov.</p><p>Type order.</p><p>Algovoracales Tedersoo &amp; Y. Ding .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 5 (positions 696–714 in S. cerevisiae tctttctttctggggaacc or ycttttcttttggggaacc; no mismatch allowed). Forms a monophyletic, least inclusive clade in Monoblepharomycota, covering sequences MF 163176, OQ 702880, EF 024210, OQ 687303, OQ 687304, OQ 687305, OQ 687310, OQ 687311, EUK 1216850, DQ 244008, UDB 014650, EUK 1124454, EUK 1216854, EUK 1216849, and OQ 687309 (Fig. 1).</p><p>Notes.</p><p>Encoded as clade GS 13 in EUKARYOME v 1.9. Algovoracomycetes currently harbors Algovoracales (ord. nov.), Solivoracales (ord. nov.), and a potential order-level group represented by the sequence OQ 687304 (lake water in MI, USA). Comprises potentially 130–160 species. Detected in soil (65.0 % out of 303 records), water (20.5 %), sediment (13.2 %), and algae (1.3 %). Algovoracomycetes includes algal parasites, but it remains unknown if this is the most common trophic strategy or characteristic of the order Algovoracales . Members of Algovoracomycetes have been recorded from high arctic to hot tropical biomes across all continents, including Antarctica.</p></div>	https://treatment.plazi.org/id/1EB976B9745450A9BFEAEF43903308C3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
4BE03F6F92B359DE8BA5A5FA42E7BA5F.text	4BE03F6F92B359DE8BA5A5FA42E7BA5F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Algovorax scenedesmi (Fott) Tedersoo & Y. Ding 2025	<div><p>Algovorax scenedesmi (Fott) Tedersoo &amp; Y. Ding comb. nov.</p><p>Basionym.</p><p>Phlyctidium scenedesmi Fott [480416].</p><p>Synonym.</p><p>Rhizophydium scenedesmi (Fott) Karling [480758].</p><p>Diagnosis.</p><p>Separation from species of Phlyctidium and Rhizophydium based on the lack of rhizoids, large sporangium (5–8 µm), and thin-walled zoospores. Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 79–98 tgttttgcataaaaacagga; one mismatch allowed) as indicated in Fig. 15. Intraspecific variation up to 1.7 % in ITS 2. Interspecific distance at least 6.7 % in ITS 2.</p><p>Type.</p><p>Species description based on illustrations in Fott (1967: 100) (holotype); parasitized algal sample CCTCC M 2015486 (epitype), eDNA sequences MF 163176 (SSU) and EUK 0509847 = OZ 253793 (ITS) obtained from the epitype; culture EPG 01, freshwater pond algae in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=100.41&amp;materialsCitation.latitude=26.38" title="Search Plazi for locations around (long 100.41/lat 26.38)">Chenghai</a>, Yunnan, China (26.38°N, 100.41°E) .</p><p>Description.</p><p>As in Fott (1967). Other sequence: EUK 0319835 (FunAqua sediment sample W 0265; Malinówka river in Krzesławicka, Poland, 49.9864°N, 20.0136°E).</p><p>Etymology.</p><p>Algovorax is derived from the Latin words algos (algae) and vorare (to devour), referring to algae eaters following the parasitic habit characteristic of the type species.</p><p>Notes.</p><p>An old species resurrected by identified specimens and DNA sequences. The eDNA sequence EUK 0319835 from Poland provides an additional link between the holotype description from Czechia and the epitype from China. There are no additional records in GlobalFungi. Algal hosts besides Scenedesmus spp. include Chlorococcum spp. and Graesiella sp. (Ding et al. 2018).</p></div>	https://treatment.plazi.org/id/4BE03F6F92B359DE8BA5A5FA42E7BA5F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
C908FF2E296055D5A3D53E5EFE4A6530.text	C908FF2E296055D5A3D53E5EFE4A6530.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Algovorax Tedersoo & Y. Ding 2025	<div><p>Algovorax Tedersoo &amp; Y. Ding gen. nov.</p><p>Type species.</p><p>Algovorax scenedesmi (Fott) Tedersoo &amp; Y. Ding .</p><p>Description.</p><p>Thallus monocentric, consisting of extramatrical, inoperculate, spherical to oval sporangium, and intramatrical spherical apophysis. Rhizoids absent. Zoospores spherical, thin-walled. Resting spores spherical, thick-walled, arising from the extramatrical sporangium. Parasitic on green algae.</p><p>Diagnosis.</p><p>Distinguishable from other genera of Monoblepharomycota by an intramatrical spherical apophysis and inoperculate sporangium. Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8 S-ITS 2 (positions starting from 150 in type species and 154 in S. cerevisiae gtgaaacctcctcaa; one mismatch allowed) and from other groups of Monoblepharomycota in SSU V 7 (positions 1485–1494 in S. cerevisiae acgagtatat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Algovoracaceae, covering sequences MF 163176, OQ 702880, EF 024210, and OQ 687303 (Figs 1, 14).</p><p>Notes.</p><p>There are potentially around 6–8 species in Algovorax based on ITS sequences, with examples including taxa represented by sequences OQ 702880 (algal sample in MI, USA), EUK 0319806 (lake sediment in Estonia), EUK 0319324 (river sediment in Italy), EUK 0319845, and EUK 0320075 (both lake sediment in Germany).</p></div>	https://treatment.plazi.org/id/C908FF2E296055D5A3D53E5EFE4A6530	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
59FF4FA3C5915D9BA37CB247CAD6B746.text	59FF4FA3C5915D9BA37CB247CAD6B746.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aphelidiomyceta Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Aphelidiomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 147 (2018)</p><p>Type class.</p><p>Aphelidiomycota Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov .</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Currently harbors Aphelidiomycota .</p></div>	https://treatment.plazi.org/id/59FF4FA3C5915D9BA37CB247CAD6B746	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
66C30CDDAAE152098DF95B0129A7512F.text	66C30CDDAAE152098DF95B0129A7512F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aphelidiomycota Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Aphelidiomycota Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 147 (2018)</p><p>Type class.</p><p>Aphelidiomycetes Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov .</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Currently harbors Aphelidiomycetes and Pantelleriomycetes (class. nov.).</p></div>	https://treatment.plazi.org/id/66C30CDDAAE152098DF95B0129A7512F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2AC2D7276E8D5414B1D372E58E83161B.text	2AC2D7276E8D5414B1D372E58E83161B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquamastigaceae Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquamastigaceae Tedersoo &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Aquamastix Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 4 (positions 966–975 gatcaagagc in S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Aquamastigales, covering sequences EUK 1124847 and EUK 0320721 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently harbors the genus Aquamastix (gen. nov.).</p></div>	https://treatment.plazi.org/id/2AC2D7276E8D5414B1D372E58E83161B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
8B25E62215D950D7970A0CB34ADCCA7F.text	8B25E62215D950D7970A0CB34ADCCA7F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquamastigales Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquamastigales Tedersoo &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Aquamastigaceae Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 4 (positions 966–975 gatcaagagc in S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Aquamastigomycetes, covering sequences EUK 1102371, EUK 1107057, EUK 1124848, EUK 1138328, EUK 1102991, EUK 1124847, and EUK 0320721 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Aquamastigaceae (fam. nov.) and potential family-level taxa represented by sequences EUK 1102371 (permafrost sample in Canada), EUK 1107057 (lake sediment sample in Sweden), EUK 1124848 (forest soil sample in Estonia), EUK 1138328 (wastewater sample in Estonia), and EUK 1102991 (lake sediment sample in Sweden).</p></div>	https://treatment.plazi.org/id/8B25E62215D950D7970A0CB34ADCCA7F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
6D83079E1F655681AD408154F575CB3D.text	6D83079E1F655681AD408154F575CB3D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquamastigomycetes Tedersoo & Esmaeilzadeh-Salestani	<div><p>Aquamastigomycetes Tedersoo &amp; Esmaeilzadeh-Salestani class. nov.</p><p>Type order.</p><p>Aquamastigales Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 4 (positions 966–975 gatcaagagc in S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Neocallimastigomycota, covering sequences EUK 1102371, EUK 1107057, EUK 1124848, EUK 1138328, EUK 1102991, EUK 1124847, and EUK 0320721 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 38 in EUKARYOME v 1.9. Currently harbors Aquamastigales (ord. nov.). Comprises 15–20 species. Detected in sediment (72.4 % out of 29 records), freshwater (6.9 %), and soil (17.2 %) samples in tundra to subtropical biomes in Eurasia, North America, and South America. The predominant records from sediments and flooded soils suggest that members of this class are facultative anaerobes.</p></div>	https://treatment.plazi.org/id/6D83079E1F655681AD408154F575CB3D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
67574F56DCA459EA8EB17CEB8D43DBA9.text	67574F56DCA459EA8EB17CEB8D43DBA9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquamastix sanduskyensis Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquamastix sanduskyensis Tedersoo &amp; Esmaeilzadeh-Salestani sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Aquamastix based on ITS 2 (positions 112–131 aatattaatatatttattaa; one mismatch allowed) and LSU (positions 471–490 aagacttataattaaaggac; one mismatch allowed) as indicated in Fig. 18. Intraspecific variation up to 1.2 % in ITS 2. Closest species differ by&gt; 20 % in ITS 2 and&gt; 10 % in LSU.</p><p>Type.</p><p>Vouchered sediment sample TUE 031498 (holotype); eDNA sequence EUK 1124847 = OZ 253794 (legitype); eDNA sample TUE 131498 (nucleotype); FunAqua sample W 0822 s, Sandusky Bay, Lake Erie, OH, USA, 41.45, –82.96 .</p><p>Description.</p><p>Other sequences: EUK 0320721 (FunAqua sediment sample W 0987 s, Szczecin Lagoon, Poland, 53.74°N, 14.44°E) and GlobalFungi accession 19 c 3 de 17 f 55 f 5 bab 0644510 c 210733 d 4 (sediment in Hulun Lake, Inner Mongolia, China, 48.86°N, 117.4°E; two biological samples).</p><p>Etymology.</p><p>Aqua (Latin) and mastix (Greek) refer to water and Neocallimastix, respectively, and Sandusky (Wyandot) refers to the cold waters and the part of Lake Erie where the type material originates.</p><p>Notes.</p><p>Found in sediments of lakes in the Northern Hemisphere (n = 3 records).</p></div>	https://treatment.plazi.org/id/67574F56DCA459EA8EB17CEB8D43DBA9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
DB2930C4813E5C6E9C1B8A033D0A419B.text	DB2930C4813E5C6E9C1B8A033D0A419B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquamastix Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquamastix Tedersoo &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Aquamastix sanduskyensis Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 120–139 ttcctctttg in type species and 118–127 in S. cerevisiae; no mismatch allowed), SSU V 9 (positions 1685–1699 agtaacttccccttg in S. cerevisiae; no mismatch allowed), and LSU D 1 (positions 125–139 in type species and 123–137 in S. cerevisiae gtgacggtttaactg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Aquamastigaceae, covering sequences EUK 1124847 and EUK 0320721 (Figs 1, 17).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises a single species, Aquamastix sanduskyensis (sp. nov.).</p></div>	https://treatment.plazi.org/id/DB2930C4813E5C6E9C1B8A033D0A419B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
A37740D8E1965B998E6602B8C1C7E3EA.text	A37740D8E1965B998E6602B8C1C7E3EA.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquieurochytriaceae Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquieurochytriaceae Tedersoo &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Aquieurochytrium Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 1 (positions 171–185 in type species and S. cerevisiae ggcaagccgggcaaa; one mismatch allowed), SSU V 4 (positions 871–885 in S. cerevisiae atactttcattagtc; one mismatch allowed), and ITS 2 (positions 173–195 in type species taatgctgggcgtcagcctgctt OR taatgacgggcgtcagcctgctt; three mismatches allowed). Forms a monophyletic, least inclusive clade in Aquieurochytriales, covering sequences AB 971081, EUK 1100022, EUK 1102113, EUK 1123700, and EUK 1102276 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Aquieurochytrium (gen. nov.) and other potentially genus-level groups represented by sequences AB 971081 (water in Japan), EUK 1123700 (freshwater sediment in New Zealand), and EUK 1100022 (permafrost in Canada).</p></div>	https://treatment.plazi.org/id/A37740D8E1965B998E6602B8C1C7E3EA	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
5D92AAD1D97C5062B56F2830AB425770.text	5D92AAD1D97C5062B56F2830AB425770.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquieurochytriales Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquieurochytriales Tedersoo &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Aquieurochytriaceae Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 1 (positions 171–185 in type species and S. cerevisiae ggcaagccgggcaaa; one mismatch allowed), SSU V 4 (positions 871–885 in S. cerevisiae atactttcattagtc; one mismatch allowed), and ITS 2 (positions 173–195 in type species taatgctgggcgtcagcctgctt OR taatgacgggcgtcagcctgctt; three mismatches allowed). Forms a monophyletic, least inclusive clade in Aquieurochytriomycetes, covering sequences AB 971081, EUK 1100022, EUK 1102113, EUK 1123700, and EUK 1102276 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Aquieurochytriaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/5D92AAD1D97C5062B56F2830AB425770	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
419B76C464CC5F879FAEA1FFB4AAD13E.text	419B76C464CC5F879FAEA1FFB4AAD13E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquieurochytriomycetes Tedersoo & Esmaeilzadeh-Salestani	<div><p>Aquieurochytriomycetes Tedersoo &amp; Esmaeilzadeh-Salestani class. nov.</p><p>Type order.</p><p>Aquieurochytriales Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 1 (positions 171–185 in type species and S. cerevisiae ggcaagccgggcaaa OR ggctgctcggacaaa; two mismatches allowed). Forms a monophyletic, least inclusive clade in Chytridiomycota, covering sequences EUK 1107407, AB 971081, EUK 1100022, EUK 1102113, EUK 1123700, and EUK 1102276 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 59 in EUKARYOME v 1.9. Currently harbors Aquieurochytriales (ord. nov.) and potentially order-level groups represented by sequences EUK 1107407 (peatland soil in Sweden), EUK 0130469 ( woodland soil in Australia), EUK 0519470 (cropland soil in Estonia), and EUK 0569228 (freshwater sediment in Estonia). Comprises potentially 50–60 species. Detected in water (53.8 % out of the 80 records), sediments (32.5 %), and soil (13.7 %) in tundra to tropical biomes in all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/419B76C464CC5F879FAEA1FFB4AAD13E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
602728F4A52257E78C933EB92F79E768.text	602728F4A52257E78C933EB92F79E768.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquieurochytrium lacustre Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquieurochytrium lacustre Tedersoo &amp; Esmaeilzadeh-Salestani sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Aquieurochytrium based on the ITS 2 (positions 297–316 gaaaggggatctgttttttt; one mismatch allowed) and LSU D 2 (positions 470–489 in type species and 450–469 in S. cerevisiae atgtcgagtccccgatcagt; no mismatch allowed) as indicated in Fig. 7. Intraspecific variation up to 1.1 % in ITS 2. Interspecific distance at least 3.4 % in ITS 2.</p><p>Type.</p><p>Vouchered aquatic eDNA sample TUE 128819 (holotype); eDNA sequence EUK 1102113 = OZ 253788 (legitype); freshwater in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=12.16&amp;materialsCitation.latitude=58.37" title="Search Plazi for locations around (long 12.16/lat 58.37)">Lake Skogaryd</a>, Sweden, 58.37°N, 12.16°E .</p><p>Description.</p><p>Other sequences: EUK 0584914 (FunAqua sample W 0790 w; lake water in Beukenlaan, Netherlands, 52.000°N, 4.487°E); EUK 0584915 (FunAqua sample W 0038 w; water in Lake Luke Vanajärv, Estonia, 58.2438°N, 26.5751°E); EUK 0584916 (FunAqua sample W 0458 w; water in Lake Stübnitzsee, Germany, 53.1071°N, 13.1891°E); EUK 0584917 (FunAqua sample W 0624 w; water in Lake Vejlsø, Denmark, 56.1514°N, 9.5618°E); EUK 0584918 (FunAqua sample W 0454 w; water in Lake Kleiner Wentowsee, Germany, 53.4494°N, 13.1052°E); and EUK 0584919 (FunAqua sample W 0364 s; sediment in Lake Ototoa, New Zealand, –36.5302, 174.2324).</p><p>Etymology.</p><p>Aqua (Latin) and Europa (Greek) refer to the habitat in European waters; and lacuster (Latin) specifies the lake habitat.</p><p>Notes.</p><p>Found in six temperate and boreal freshwater lakes in Central and Northern Europe, with one record from New Zealand (sequences differ by one nucleotide from closest European records; sequenced in an independent library). The eight additional GlobalFungi records originate from lake water in Scandinavia.</p></div>	https://treatment.plazi.org/id/602728F4A52257E78C933EB92F79E768	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
CD469F26842156BD9CF05B38F3BBABCC.text	CD469F26842156BD9CF05B38F3BBABCC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquieurochytrium Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Aquieurochytrium Tedersoo &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Aquieurochytrium lacustre Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 160–168 ccgcgacga; one mismatch allowed) and LSU D 2 (positions 618–637 in type species and 591–610 in S. cerevisiae tcgcagcgcaccgtaaggcg). Forms a monophyletic, least inclusive clade in Aquieurochytriaceae, covering sequences EUK 1102113 and EUK 1102276 (Figs 1, 6).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially 25–30 species represented by sequences EUK 1102276 (lake water in Sweden), EUK 0569233 (lake water in Estonia), and EUK 0569237 (lake water in Benin).</p></div>	https://treatment.plazi.org/id/CD469F26842156BD9CF05B38F3BBABCC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
9DB42ADB8BE252F29DDF699CF5AD0277.text	9DB42ADB8BE252F29DDF699CF5AD0277.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Asteraceae Tedersoo 2025	<div><p>Ruderaliaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Ruderalia Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 209–222 in type species aacgatagtgaagt; two mismatches allowed). Forms a monophyletic, least inclusive clade in Ruderaliales, covering sequences EUK 1138161, EUK 1137899, EUK 0531800, and EUK 1124460 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Ruderaliaceae is currently monogeneric.</p></div>	https://treatment.plazi.org/id/9DB42ADB8BE252F29DDF699CF5AD0277	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
97A81F34F6225DFF985A49B505AE76A4.text	97A81F34F6225DFF985A49B505AE76A4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Borikenia Tedersoo 2025	<div><p>Borikenia Tedersoo gen. nov.</p><p>Type species.</p><p>Borikenia urbinae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1684–1703 in S. cerevisiae tgcggtccacatgttggcaa; one mismatch allowed) and ITS 2 (positions 26–45 in type species ttggtggacttggtcgttca; two mismatches allowed). Forms a monophyletic, least inclusive clade in Borikeniaceae, covering sequences EUK 1189254, EUK 0530094, and EUK 0530090 (Figs 1, 51).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises four potential species represented by sequences EUK 0530090 (forest soil in India), EUK 0530094 (forest soil in Colombia), and EUK 0530095 (forest soil in Costa Rica).</p></div>	https://treatment.plazi.org/id/97A81F34F6225DFF985A49B505AE76A4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
41E2A976CEEE5A6DB75BCFAE71303BE2.text	41E2A976CEEE5A6DB75BCFAE71303BE2.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Borikenia urbinana Tedersoo 2025	<div><p>Borikenia urbinana Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Borikenia based on ITS 2 (positions 56–75 acgttgtgtacacacacgtg; one mismatch allowed) and LSU (positions 170–189 ctgatcttggttgttgggta; one mismatch allowed) as indicated in Fig. 52. Intraspecific variation up to 2.3 % in ITS 2 and up to 0.4 % in LSU. Interspecific distance at least 6.1 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 002010 (holotype); eDNA sequence EUK 1189254 = OZ 253812 (legitype); eDNA sample TUE 102010 (nucleotype); GSMc plot G 5033, tropical rainforest soil in Luquillo, Puerto Rico, 18.3146, –65.747 .</p><p>Description.</p><p>Other sequences: EUK 1102667 (tropical rainforest soil in El Yunque, Puerto Rico, 18.29, – 65.78); EUK 0330861 (GSMc plot AV 207, tropical rainforest soil in Puerto Santander, Colombia, – 0.6161, –72.401); EUK 0330863 (GSMc plot S 1227, Eucalyptus plantation soil in Ayapel, Colombia, 8.27, – 75.2); EUK 0330864 (GSMc plot S 1026, tropical rainforest soil in Matouta, Reunion, France, – 21.3522°N, 55.7059°E); EUK 0330862 (GSMc plot S 003, Uapaca tropical forest soil in Manangotry, Madagascar, –24.745, 46.852); EUK 0330869 (GSMc plot S 048, tropical rainforest soil in El Yunque, Puerto Rico, 18.3167, – 65.8167°E); EUK 0330870 (GSMc plot JYK 035, Eucalyptus plantation soil in Rivercess, Liberia, 5.7282, –9.629); and EUK 0330871 (GSMc plot S 1267, tropical rainforest soil in Khong Ngam, Thailand, 20.2433°N, 100.0981°E).</p><p>Etymology.</p><p>&gt; Boriken (Taino) refers to Puerto Rico, where the type material originates, and Urbina (Spanish) refers to Hector Urbina, who was the first to collect material from this species (EUK 1102667).</p><p>Notes.</p><p>Found in tropical grassland and forest soils in America, Africa, and Asia (11 localities). GlobalFungi reveals an additional record from subtropical forest soil in China.</p></div>	https://treatment.plazi.org/id/41E2A976CEEE5A6DB75BCFAE71303BE2	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
C3FDB6E50AAA531EABFA738C8E522988.text	C3FDB6E50AAA531EABFA738C8E522988.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Borikeniaceae Tedersoo 2025	<div><p>Borikeniaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Borikenia Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 3 (positions 956–967 in type species and 761–772 in S. cerevisiae tcaatttattga; no mismatch allowed) and 5.8S (positions 130–142 in type species and 132–144 in S. cerevisiae aagagtatttctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Borikeniales, covering sequences EUK 1189254, EUK 0530094, EUK 0530090, EUK 1189255, and EUK 1189256 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes the genus Borikenia (gen. nov.) and another potential genus-level group represented by sequences EUK 1189255 (forest soil in the British Virgin Islands) and EUK 1189256 (forest soil in Dominica).</p></div>	https://treatment.plazi.org/id/C3FDB6E50AAA531EABFA738C8E522988	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
55DBFC6882BA52F689EC30B79A436A7C.text	55DBFC6882BA52F689EC30B79A436A7C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Borikeniales Tedersoo 2025	<div><p>Borikeniales Tedersoo ord. nov.</p><p>Type family.</p><p>Borikeniaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 3 (positions 956–967 in type species and 761–772 in S. cerevisiae tcaatttattga OR ggaatttattcc; no mismatch allowed). Forms a monophyletic, least inclusive clade in Borikeniomycetes, covering sequences EUK 1105319, EUK 1189257, EUK 0530094, EUK 0530090, EUK 1189254, EUK 1189255, and EUK 1189256 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Borikeniaceae (fam. nov.) and potentially a family-level group represented by sequences EUK 1189257 (forest soil in Dominica) and EUK 1105319 (forest soil in Puerto Rico).</p></div>	https://treatment.plazi.org/id/55DBFC6882BA52F689EC30B79A436A7C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
9A4688DE408655E5ADEE2A888180984B.text	9A4688DE408655E5ADEE2A888180984B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Borikeniomycetes Tedersoo	<div><p>Borikeniomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Borikeniales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 3 (positions 956–967 in type species and 761–772 in S. cerevisiae tcaatttattga OR ggaatttattcc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Borikeniomycota, covering sequences EUK 1105319, EUK 1189257, EUK 0530094, EUK 0530090, EUK 1189254, EUK 1189255, and EUK 1189256 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently harbors Borikeniales (ord. nov.).</p></div>	https://treatment.plazi.org/id/9A4688DE408655E5ADEE2A888180984B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
95C666707222579A86001BA54F951155.text	95C666707222579A86001BA54F951155.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Borikeniomycota Tedersoo 2025	<div><p>Borikeniomycota Tedersoo phyl. nov.</p><p>Type class.</p><p>Borikeniomycetes Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 3 (positions 956–967 in type species and 761–772 in S. cerevisiae tcaatttattga OR ggaatttattcc; two mismatches allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 1105319, EUK 1189257, EUK 0530094, EUK 0530090, EUK 1189254, EUK 1189255, and EUK 1189256 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 47 in EUKARYOME v 1.9. Currently harbors Borikeniomycetes (class. nov.). Comprises potentially 15–16 species. Detected exclusively from soil (all 48 records) in warm temperate to wet tropical biomes across all continents except Antarctica. A single record is from tundra soil (EUK 0530093; Russian Federation). The group is mainly distributed in the Neotropics (72.9 % records), especially the Antilles and Colombia.</p></div>	https://treatment.plazi.org/id/95C666707222579A86001BA54F951155	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
EFE68EAB30B55D6E99FBA142E79AA7E8.text	EFE68EAB30B55D6E99FBA142E79AA7E8.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Bryolpidiaceae Tedersoo 2025	<div><p>Bryolpidiaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Bryolpidium Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1706–1719 in S. cerevisiae gtcgagaagttatc; one mismatch allowed), ITS 2 (positions 102–113 in type species agngaacagcgg; one mismatch allowed), and LSU D 1 (positions 169–183 in type species and 167–181 in S. cerevisiae cgcggctgccgaagt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Bryolpidiales, covering sequences EUK 1124873 and EUK 1608195 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises Bryolpidium (gen. nov.).</p></div>	https://treatment.plazi.org/id/EFE68EAB30B55D6E99FBA142E79AA7E8	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
40A362F482A05E778C70FD24395E2B23.text	40A362F482A05E778C70FD24395E2B23.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Bryolpidiales Tedersoo 2025	<div><p>Bryolpidiales Tedersoo ord. nov.</p><p>Type family.</p><p>Bryolpidiaceae Esmaeilzadeh-Salestani.</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 1 (positions 169–183 in type species and 167–181 in S. cerevisiae cgcggctgccgaagt or ggtcgcgaccgcggt; one mismatch allowed) and ITS 2 (positions 102–113 in type species agngaacagcgg or aggcacggcagt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Bryolpidiomycetes, covering sequences EUK 1124873 and EUK 1608195 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Bryolpidiaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/40A362F482A05E778C70FD24395E2B23	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
8B01EF6BB6805E1BB72FDF9EBA853814.text	8B01EF6BB6805E1BB72FDF9EBA853814.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Bryolpidiomycetes Tedersoo	<div><p>Bryolpidiomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Bryolpidiales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 1 (positions 169–183 in the type species and 167–181 in S. cerevisiae cgcggctgccgaagt or ggtcgcgaccgcggt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Olpidiomycota, covering sequences EUK 1124873, EUK 1608195, EUK 1186288, and EUK 1186289 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 93 G in EUKARYOME v 1.9. Currently harbors Bryolpidiales (ord. nov.) and another potentially order-level group represented by sequences EUK 1186288 and EUK 1186289 (both forest soil in Altay Kray, Russian Federation). Comprises potentially 10–11 species. Detected in soil (88.5 % out of the 26 records) and sediments (11.5 %) in tundra to hot tropical biomes across all continents, including Sub-Antarctic islands.</p></div>	https://treatment.plazi.org/id/8B01EF6BB6805E1BB72FDF9EBA853814	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
DD346D1BA97F5C6BA0E980B5DEEC1FB6.text	DD346D1BA97F5C6BA0E980B5DEEC1FB6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Bryolpidium mundanum Tedersoo 2025	<div><p>Bryolpidium mundanum Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Bryolpidium based on ITS 2 (positions 226–245 ctgaaaacaattcgagtgat; no mismatch allowed) and LSU (positions 465–494 gacggggctctcgctcgtga; no mismatch allowed) as indicated in Fig. 38. Intraspecific variation up to 4.4 % in ITS 2. Interspecific distance&gt; 20 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 028510 (holotype); eDNA sequence EUK 1124873 = OZ 253805 (legitype); eDNA sample TUE 128510 (nucleotype); GSMc plot G 5911, wasteland soil in Tartu, Estonia, 58.3809°N, 26.6917°E .</p><p>Description.</p><p>Other sequences: EUK 0530197 (GSMc plot G 6091, subtropical desert soil in Al Zita, Saudi Arabia, 28.9243°N, 35.4438°E); EUK 0530198 (urban park soil in Mildura, VIC, Australia, – 34.1854°N, 142.1696°E); EUK 0649726 (urban soil in Põlva, Estonia, 58.0666°N, 27.0939°E); and GlobalFungi records d 4847020 b 222 e 5 b 7830540 d 220 e 20499 (subtropical woodland soil in El Tepeyac, San Luis Potosi, Mexico, 57.7165°N, 27.0549°E); 32232805 aef 1 d 4510876 e 11 cba 753 f 7 d (temperate shrubland soil in Elche, Spain, 38.30, – 0.72); and 156 ae 55 aafdd 258247 d 24 e 567 a 23 cdf 3 (temperate forest soil in Ait Tamlil, Morocco, 31.56, – 6.99).</p><p>Etymology.</p><p>&gt; Bryum (Greek and Latin) refers to its common habitat amongst mosses, and mundanum (Latin) refers to cosmopolitan distribution.</p><p>Notes.</p><p>Found in soil in urban (3 out of 4 records) and natural environments in Europe, the Arab Peninsula, and Australia. The soil habitat is supported by three additional GlobalFungi records from natural habitats in Spain, Morocco, and Mexico.</p></div>	https://treatment.plazi.org/id/DD346D1BA97F5C6BA0E980B5DEEC1FB6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
CB3E75E16D0D54358DD557003FB3FF6A.text	CB3E75E16D0D54358DD557003FB3FF6A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Bryolpidium Tedersoo 2025	<div><p>Bryolpidium Tedersoo gen. nov.</p><p>Type species.</p><p>Bryolpidium mundanum Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1706–1719 in S. cerevisiae gtcgagaagttatc; one mismatch allowed), ITS 2 (positions 102–113 in type species agngaacagcgg; one mismatch allowed), and LSU D 1 (positions 169–183 in type species and 167–181 in S. cerevisiae cgcggctgccgaagt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Bryolpidiaceae, covering sequences EUK 1124873 and EUK 1608195 (Figs 1, 37).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises 9–10 species represented by sequences EUK 1608195 (forest soil in Morocco), EUK 0044951 (grassland soil in Kyrgyzstan), EUK 0534697 (forest soil in Pakistan), EUK 0045451 (tundra soil in Leonie Island, Antarctica), EUK 0320829 (lake sediment in Germany), EUK 0534698 (grassland soil in Kyrgyzstan), EUK 0574099 (river sediment in Scotland), and EUK 0534695 (forest soil in Turkey).</p></div>	https://treatment.plazi.org/id/CB3E75E16D0D54358DD557003FB3FF6A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
6422C218627652E2A2B77C965D54FD6A.text	6422C218627652E2A2B77C965D54FD6A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Calcarisporiellomycetes Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Calcarisporiellomycetes Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 152 (2018)</p><p>Type order.</p><p>Calcarisporiellales Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov .</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Calcarisporiellales and Terrincolales (ord. nov.).</p></div>	https://treatment.plazi.org/id/6422C218627652E2A2B77C965D54FD6A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
18D6DA70537B5ABDB8490BB0CEF094F9.text	18D6DA70537B5ABDB8490BB0CEF094F9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Calcarisporiellomycota Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Calcarisporiellomycota Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 152 (2018)</p><p>Type class.</p><p>Calcarisporiellomycetes Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov .</p><p>Description.</p><p>As in Tedersoo et al. (2018)</p></div>	https://treatment.plazi.org/id/18D6DA70537B5ABDB8490BB0CEF094F9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2F9B1523A43A59DFB9D54A87FB1EA3D2.text	2F9B1523A43A59DFB9D54A87FB1EA3D2.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cantoromastigaceae Tedersoo 2025	<div><p>Cantoromastigaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Cantoromastix Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 117–136 in type species and S. cerevisiae ctttcgggtaayccccggga; one mismatch allowed) and ITS 2 (positions 156–170 in type species cgtaaccaaaaggct or cgtaccaratctttt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Cantoromastigales, covering sequences EUK 1124338, EUK 0136917, EUK 0017791, and EUK 0523855 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Cantoromastix (gen. nov.) and another potentially genus-level group represented by the sequence EUK 0523855 (forest soil in FL, USA).</p></div>	https://treatment.plazi.org/id/2F9B1523A43A59DFB9D54A87FB1EA3D2	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
DB68778F7C60562596894A72C7977263.text	DB68778F7C60562596894A72C7977263.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cantoromastigales Tedersoo 2025	<div><p>Cantoromastigales Tedersoo ord. nov.</p><p>Type family.</p><p>Cantoromastigaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in the LSU 5 ’ end (positions – 2–8 in the type species and S. cerevisiae acgtggtctc or atatggtctc; no mismatch allowed). Forms a monophyletic, least inclusive clade in Cantoromastigomycetes, covering sequences EUK 1152054, EUK 1103194, EUK 1216883, EUK 1124338, EUK 1103697, EUK 1216882, EUK 1124339, EUK 1124340, KU 359437, EUK 1216885, EUK 1137900, and EUK 1216886 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Cantoromastigaceae (fam. nov.) and other potentially order-level groups represented by sequences EUK 1152054 (forest soil in New Zealand), EUK 1103194 (lake water in Sweden), EUK 1216883 (river sediment in Romania), EUK 1103697 (forest soil in Puerto Rico), EUK 1216882 (forest soil in the Canary Islands), EUK 1124339 (grassland soil in Estonia), EUK 1124340 (greenhouse soil in Estonia), KU 359437 (plantation soil in China), EUK 1216885 (forest soil in Estonia), EUK 1137900 (urban soil in Estonia), and EUK 1216886 (forest soil in Estonia).</p></div>	https://treatment.plazi.org/id/DB68778F7C60562596894A72C7977263	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
72FD6806E94356B586029927B9DA642F.text	72FD6806E94356B586029927B9DA642F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cantoromastigomycetes Tedersoo	<div><p>Cantoromastigomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Cantoromastigales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 6 (positions 1759–1778 in type species and 1662–1681 in S. cerevisiae ggagacgtcgggdggagccc; no mismatch allowed). Forms a monophyletic, least inclusive clade in Neocallimastigomycota, covering sequences EUK 1107297, EUK 1201627, OQ 687232, OQ 687239, EUK 1103194, EUK 1188586, EUK 1152054, EUK 1103194, EUK 1216883, EUK 1124338, EUK 1103697, EUK 1216882, EUK 1124339, EUK 1124340, KU 359437, EUK 1216885, EUK 1137900, and EUK 1216886 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 39 in EUKARYOME v 1.9. Currently harbors Cantoromastigales (ord. nov.) and potential order-level groups represented by sequences EUK 1107297 (peatland soil in Sweden), EUK 1201627 (forest soil in Italy), OQ 687232 (lake water in MI, USA), and OQ 687239 (unspecified water). Comprises around 130–140 species. Detected in soil (99.0 % out of 220 records), water (0.5 %), and sediment (0.5 %) in tundra to hot tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/72FD6806E94356B586029927B9DA642F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
EF7FD2A032A558FD981137C6BD3A9DBB.text	EF7FD2A032A558FD981137C6BD3A9DBB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cantoromastix holarctica Tedersoo 2025	<div><p>Cantoromastix holarctica Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Cantoromastix based on ITS 2 (positions 33–52 actcgtaaaccattagtttt; one mismatch allowed) and LSU D 2 (positions 679–698 ttactcggccatgttagtct; one mismatch allowed) as indicated in Fig. 20. Intraspecific variation up to 1.1 % in ITS 2. Interspecific distance&gt; 20 % in ITS 2 and&gt; 15 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 000915 (holotype); eDNA sequence EUK 1124338 = OZ 253795 (legitype); eDNA sample TUE 100915 (nucleotype); GSMc plot S 383, urban park soil in Tartu, Estonia, 58.3889°N, 26.7031°E .</p><p>Description.</p><p>Other sequences: EUK 0482535 (temperate fallow soil in Haava, Estonia, 58.4611°N, 26.7738°E); EUK 0330677 ( Populus tremula forest soil in Vasula, Estonia, 58.4699°N, 26.7266°E); and EUK 0330675 (GSMc plot G 5923, Malus domestica cropland soil in Kalnabeites, Latvia, 57.1333°N, 24.8567°E); EUK 0330674 (GSMc plot G 5920, temperate grassland soil in Viinamärdi, Estonia, 58.2497°N, 26.5394°E); EUK 0330670 (temperate grassland soil in Kihnu, Estonia, 58.1467°N, 23.9852°E); EUK 0330673 (GSMc plot G 5930, Zea mays cropland soil in Saulkalne, Latvia, 56.8442°N, 24.4072°E); and EUK 0330671 (coppiced fallow soil in Lombi, Estonia, 58.4551°N, 26.7451°E).</p><p>Etymology.</p><p>Cantor (Latin) refers to singers, which reflects the origin of the type material at the song festival grounds, and mastix refers to Neocallimastix; and holos and arcticos (Greek) refer to the entire northern (holarctic) distribution of the type species.</p><p>Notes.</p><p>Found in eight soil samples in Estonia and Latvia. GlobalFungi records (n = 263) suggest a broader distribution in temperate North American and East Asian soils and a preference for treeless habitats.</p></div>	https://treatment.plazi.org/id/EF7FD2A032A558FD981137C6BD3A9DBB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
C8743E36712B55F4968E3424896724DD.text	C8743E36712B55F4968E3424896724DD.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Cantoromastix Tedersoo 2025	<div><p>Cantoromastix Tedersoo gen. nov.</p><p>Type species.</p><p>Cantoromastix holarctica Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 123–137 in type species ctagtcatctttaag; two mismatches allowed) and SSU 3 ’ end (positions 1796–1800 in S. cerevisiae and 5 bases of ITS: cattagctta; no mismatch allowed). Forms a monophyletic, least inclusive clade in Cantoromastigaceae, covering sequences EUK 1124338, EUK 0136917, and EUK 0017791 (Figs 1, 19).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises 2–3 potential species represented by sequences EUK 0136917 (forest soil in Costa Rica) and EUK 0017791 (forest soil in Guadeloupe).</p></div>	https://treatment.plazi.org/id/C8743E36712B55F4968E3424896724DD	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
95D6714BF69750D9A4C12A7B31B32C69.text	95D6714BF69750D9A4C12A7B31B32C69.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chthonolpidiaceae Tedersoo 2025	<div><p>Chthonolpidiaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Chthonolpidium Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 142–154 in type species and 143–155 in S. cerevisiae tgttcgacaycc; one mismatch allowed) and LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chthonolpidiales, covering sequences EUK 1124876, EUK 0534797, EUK 0534798, EUK 0534818, EUK 1191212, and EUK 1138033 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Chthonolpidium (gen. nov.) and potentially other genera represented by sequences EUK 1191212 (forest soil in Puerto Rico), EUK 0534797 (urban soil in China), EUK 0534798 (grassland soil in Norway), and EUK 0534818 (forest soil in Colombia).</p></div>	https://treatment.plazi.org/id/95D6714BF69750D9A4C12A7B31B32C69	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
1C91CB5B5110501792CBDBA1E69B6915.text	1C91CB5B5110501792CBDBA1E69B6915.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chthonolpidiales Tedersoo 2025	<div><p>Chthonolpidiales Tedersoo ord. nov.</p><p>Type family.</p><p>Chthonolpidiaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; two mismatches allowed). Forms a monophyletic, least inclusive clade in Chthonolpidiomycetes, covering sequences EUK 1124876, EUK 0534797, EUK 0534798, EUK 0534818, EUK 1191212, and EUK 1138033 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Chthonolpidiaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/1C91CB5B5110501792CBDBA1E69B6915	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
636BADF25750582182628E5AEE2541A5.text	636BADF25750582182628E5AEE2541A5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chthonolpidiomycetes Tedersoo	<div><p>Chthonolpidiomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Chthonolpidiales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in LSU D 2 (positions 695–714 in type species and 604–623 in S. cerevisiae gactgcttgcaggctgcata; three mismatches allowed). Forms a monophyletic, least inclusive clade in Olpidiomycota, covering sequences EUK 1124876, EUK 0534818, EUK 0534797, EUK 1191212, and EUK 1138033 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 93 K in EUKARYOME v 1.9. Currently harbors Chthonolpidiales (ord. nov.). Comprises potentially 25–30 species. Detected in soil (95.9 % out of the 73 records) and mosses (4.1 %) in tundra to hot tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/636BADF25750582182628E5AEE2541A5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3303B4C9453152FF9F96525C1F11041B.text	3303B4C9453152FF9F96525C1F11041B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chthonolpidium enigmatum Tedersoo 2025	<div><p>Chthonolpidium enigmatum Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Chthonolpidium based on ITS 2 (positions 245–264 cacttggctgaaaaggttt; one mismatch allowed) and LSU (positions 608–627 ccttctagccctacggtacg; no mismatch allowed) as indicated in Fig. 40. Intraspecific variation up to 4.8 % in ITS 2. Interspecific distance at least 10.3 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 028510 (holotype); eDNA sequence EUK 1138033 = OZ 253806 (legitype); eDNA sample TUE 128510 (nucleotype); moss-dominated wasteland soil in Tartu, Estonia, 58.3808°N, 26.6917°E .</p><p>Description.</p><p>Other sequences: EUK 0534827 (type location); EUK 0534801 (temperate shrubland soil in Bliss, MI, USA); and EUK 0534800 (GSMc plot G 6167, subtropical shrubland soil in Al Hiwayb, Oman, 23.2140°N, 57.3337°E); and from GlobalFungi: 3949559 c 2 adbb 6 dd 485 ee 858 c 50 aa 75 b (shrubland soil in Morocco, 33.9766, – 3.3735°E); 170 f 6 c 5254 bf 08 a 8 d 3 be 2909670 b 3 d 85 (coniferous woodland soil in Utah, USA, 37.5819, – 109.91); 3 f 89 b 0 fffeb 9329 f 6 db 10351 b 45 fd 923 ( woodland rhizosphere soil in Spain, 37.888, –3.634); and 03 a 49631062976236 cecf 37723044 ad 8 (shrubland soil in Tunisia, 35.1678°N, 8.6738°E).</p><p>Etymology.</p><p>&gt; Khthonios (Greek) refers to the common underground habitat, and enigma (Greek) means puzzling or mysterious.</p><p>Notes.</p><p>All four EUKARYOME and eight GlobalFungi records are derived from soil. Found in dry habitats in North Africa, Estonia, Spain, Oman, and the USA, indicating a cosmopolitan distribution.</p></div>	https://treatment.plazi.org/id/3303B4C9453152FF9F96525C1F11041B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
C235C11C77EC5A90941A59E7D337C4F3.text	C235C11C77EC5A90941A59E7D337C4F3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chthonolpidium Tedersoo 2025	<div><p>Chthonolpidium Tedersoo gen. nov.</p><p>Type species.</p><p>Chthonolpidium enigmatum Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 60–74 gggccaagctggtta; one mismatch allowed) and LSU D 2 (positions 672–686 in type species and 604–618 in S. cerevisiae ttgcagttgggcgcc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chthonolpidiaceae, covering sequences EUK 1124876 and EUK 1138033 (Figs 1, 39).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially four species represented by sequences EUK 1124876 (mosses in Estonia), EUK 0534819 (tundra soil in AK, USA), and EUK 0534804 (grassland soil in Tibet).</p></div>	https://treatment.plazi.org/id/C235C11C77EC5A90941A59E7D337C4F3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
65AF78153662523F8BB39E6669C93901.text	65AF78153662523F8BB39E6669C93901.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chytridiomyceta Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Chytridiomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 148 (2018)</p><p>Type class.</p><p>Chytridiomycota Doweld.</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Currently harbors the phyla Chytridiomycota, Monoblepharomycota, and Neocallimastigomycota.</p></div>	https://treatment.plazi.org/id/65AF78153662523F8BB39E6669C93901	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
BA5B3EFB0C6350A999F16BEEFECAFD47.text	BA5B3EFB0C6350A999F16BEEFECAFD47.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Chytridiomycota Doweld	<div><p>Chytridiomycota Doweld, Prosyllabus Tracheophytorum, Tentamen systematis plantarum vascularium (Tracheophyta): LXXVII (2001)</p><p>Type class.</p><p>Chytridiomycetes Caval.-Sm.</p><p>Description.</p><p>As in Doweld (2001).</p><p>Notes.</p><p>Currently harbors the classes Caulochytriomycetes, Chytridiomycetes, Cladochytriomycetes, Lobulomycetes, Mesochytriomycetes, Polychytriomycetes, Rhizophydiomycetes, Rhizophlyctidomycetes, Spizellomycetes, Synchytriomycetes, Aquieurochytriomycetes (class. nov), Edaphochytriomycetes (class. nov.), Tibetochytriomycetes (class. nov.), and Tropicochytriomycetes (class. nov.), and potentially class-level groups represented by sequences EUK 1102715 (forest soil in Puerto Rico), EUK 1107652 (peatland soil in Sweden), and EUK 1104403 (forest soil in Sweden).</p></div>	https://treatment.plazi.org/id/BA5B3EFB0C6350A999F16BEEFECAFD47	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
0FEC9C809B775CE888DB4FA58FBB5613.text	0FEC9C809B775CE888DB4FA58FBB5613.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Curlevskia holarctica Tedersoo 2025	<div><p>Curlevskia holarctica Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Curlevskia based on ITS 2 (positions 187–206 acgcttytgtgacttcctcc; two mismatches allowed) and LSU D 2 (positions 493–512 caatgttcagcgcccctcgt; no mismatch allowed) as indicated in Fig. 30. Intraspecific variation up to 2.1 % in ITS 2 and 1.3 % in LSU. Interspecific distance at least 4.4 % in ITS 2 and 2.8 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 002212 (holotype); eDNA sequence EUK 1124409 = OZ 253801 (legitype); eDNA sample TUE 102212 (nucleotype); GSMc plot G 5235, Larix sp. plantation in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.7742&amp;materialsCitation.latitude=58.3835" title="Search Plazi for locations around (long 26.7742/lat 58.3835)">Rõõmu</a>, Estonia, 58.3835°N, 26.7742°E .</p><p>Description.</p><p>Other sequences: EUK 1630897 (GSMc plot G 4803, Ulmus-Alnus forest soil in Meegaste, Estonia, 58.0563°N, 26.3355°E); EUK 1603984 (GSMc plot G 5821, gravel quarry soil in Siimusti, Estonia, 58.7306°N, 26.3198°E); EUK 1602442 (GSMc plot G 4128, Quercus robur woodland soil in Ööriku, Estonia, 58.5831°N, 22.9322°E); and EUK 1700061 (GSMc plot IH. ME 05, Abies forest soil in Mestia, Georgia, 43.0209°N, 42.7325°E).</p><p>Etymology.</p><p>Curlevski refers to Nathalie J. A. Curlevski, who was the first to collect material of this genus (GU 187865; Curlevski et al. 2014), and holarctica refers to its distribution.</p><p>Notes.</p><p>Found in soil in four contrasting sites in Estonia and once in Georgia. The 11 additional records in GlobalFungi point to a broader distribution in Eurasian and North American soils.</p></div>	https://treatment.plazi.org/id/0FEC9C809B775CE888DB4FA58FBB5613	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
1CE152A924965A72A72A43EC0B83B291.text	1CE152A924965A72A72A43EC0B83B291.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Curlevskia Tedersoo 2025	<div><p>Curlevskia Tedersoo gen. nov.</p><p>Type species.</p><p>Curlevskia holarctica Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 88–97 in type species tcgcgaatcc; one mismatch allowed) and LSU D 2 (positions 565–574 in type species and 509–518 in S. cerevisiae atcgcgggaa; one mismatch allowed). Forms a monophyletic, least inclusive clade in Curlevskiaceae, covering sequences EUK 1603989, EUK 1603990, KF 849654, EUK 1103703, EUK 1603986, EUK 1602443, EUK 1603988, EUK 1124409, and EUK 1630897 (Figs 1, 29).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises 40–60 species represented by sequences EUK 1603985 (wasteland soil in Estonia), EUK 1603986 (cropland soil in Estonia), EUK 1603987 (grassland soil in Estonia), EUK 1603988 (wasteland soil in Estonia), KJ 701460, KJ 701455, and KF 849654 (all from plant roots in China), GU 187865 ( woodland soil in VIC, Australia), and EUK 1103703 (forest soil in Puerto Rico).</p></div>	https://treatment.plazi.org/id/1CE152A924965A72A72A43EC0B83B291	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
266F379124AF5BDFB449CC127074AB0E.text	266F379124AF5BDFB449CC127074AB0E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Curlevskiaceae Tedersoo 2025	<div><p>Curlevskiaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Curlevskia Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 88–97 tcgcgaatcc or tcgcaaaacg; one mismatch allowed) and LSU D 2 (positions 541–550 in type species and 486–495 in S. cerevisiae cacgcaggtc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Curlevskiales, covering sequences EUK 1700102, EUK 1603989, EUK 1603990, KF 849654, EUK 1103703, EUK 1603986, EUK 1602443, EUK 1603988, EUK 1124409, and EUK 1630897 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Curlevskia and another potentially genus-level group represented by sequences EUK 1700102 (forest soil in VIC, Australia).</p></div>	https://treatment.plazi.org/id/266F379124AF5BDFB449CC127074AB0E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
639BAD8678745BE98628B740BFE547C6.text	639BAD8678745BE98628B740BFE547C6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Curlevskiales Tedersoo 2025	<div><p>Curlevskiales Tedersoo ord. nov.</p><p>Type family.</p><p>Curlevskiaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 88–97 tcgcgaatcc or tcgcaaaacg; one mismatch allowed) and LSU D 2 (positions 541–550 in type species and 486–495 in S. cerevisiae cacgcaggtc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Curlevskiomycetes, covering sequences EUK 1700102, EUK 1603989, EUK 1603990, KF 849654, EUK 1103703, EUK 1603986, EUK 1602443, EUK 1603988, EUK 1124409, and EUK 1630897 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Curlevskiaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/639BAD8678745BE98628B740BFE547C6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
5FB813020D3D5E6BB94E2B2D09832961.text	5FB813020D3D5E6BB94E2B2D09832961.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Curlevskiomycetes Tedersoo	<div><p>Curlevskiomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Curlevskiales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 2 (positions 549–559 in type species and 494–504 in S. cerevisiae tcagcgtcagc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Curlevskiomycota, covering sequences EUK 1103826, EUK 1103868, EUK 1700102, EUK 1603989, EUK 1603990, KF 849654, EUK 1103703, EUK 1603986, EUK 1602443, EUK 1603988, EUK 1124409, and EUK 1630897 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently harbors Curlevskiales (ord. nov.) and potentially 1–2 order-level groups represented by sequences EUK 1103826 (forest soil in Puerto Rico) and EUK 1700078 (forest soil in Gabon).</p></div>	https://treatment.plazi.org/id/5FB813020D3D5E6BB94E2B2D09832961	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
8AA271D4AAE952EFB2B4E3DDF66B55D9.text	8AA271D4AAE952EFB2B4E3DDF66B55D9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Curlevskiomycota Tedersoo 2025	<div><p>Curlevskiomycota Tedersoo phyl. nov.</p><p>Type class.</p><p>Curlevskiomycetes Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in the LSU 5 ’ end (positions 52–73 in the type species and S. cerevisiae ccgaggaaaagaaactaacaag or tggaggaaaagaaaaaaacatt; no mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 1124408, EUK 1103576, MG 664460, EUK 1700038, EUK 1700047, EUK 1124407, EUK 1631674, EUK 1103826, EUK 1103868, EUK 1700102, EUK 1603989, EUK 1603990, KF 849654, EUK 1103703, EUK 1603986, EUK 1602443, EUK 1603988, EUK 1124409, and EUK 1630897 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 50 in EUKARYOME v 1.9. Currently harbors Curlevskiomycetes (class. nov.) and potentially several class-level groups represented by sequences EUK 1124408 (wetland soil in Estonia), EUK 1103576 (forest soil in Puerto Rico), MG 664460 (cropland soil in China), EUK 1700038 ( woodland soil in NT, Australia), EUK 1700047 (desert soil in Saudi Arabia), EUK 1124407 (wasteland soil in Estonia), and EUK 1631674 (forest soil in Estonia). Comprises potentially 100–120 species. Detected in soil (97.5 % out of the 163 records) and plant roots (1.8 %) in boreal forest to hot tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/8AA271D4AAE952EFB2B4E3DDF66B55D9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
37CDD1AD61AB5A4E8C9714769B597B86.text	37CDD1AD61AB5A4E8C9714769B597B86.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dobrisimastigaceae Tedersoo 2025	<div><p>Dobrisimastigaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Dobrisimastix Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 region (positions 2–18 in type species taaaatrtcacaaccac; three mismatches allowed), SSU V 4 (positions 700–719 in S. cerevisiae ctggtgaatcatcgtgctct; one mismatch allowed), and LSU D 1 (positions 124–138 in the type species and 122–136 in S. cerevisiae tgggtaggttacctg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Dobrisimastigales, covering sequences EUK 1189296, EUK 1138904, EUK 0534669, EUK 0534670, and EUK 0534680 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises Dobrisimastix (gen. nov.).</p></div>	https://treatment.plazi.org/id/37CDD1AD61AB5A4E8C9714769B597B86	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
1A475CDED4F6562984983968787F95B5.text	1A475CDED4F6562984983968787F95B5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dobrisimastigales Tedersoo 2025	<div><p>Dobrisimastigales Tedersoo ord. nov.</p><p>Type family.</p><p>Dobrisimastigaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 700–719 in S. cerevisiae ctggtgaatcatcgtgctct; one mismatch allowed) and LSU D 1 (positions 124–138 in the type species and 122–136 in S. cerevisiae tgggtaggttacctg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Dobrisimastigomycetes, covering sequences EUK 1189296, EUK 1138904, EUK 0534669, EUK 0534670, and EUK 0534680 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Dobrisimastigaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/1A475CDED4F6562984983968787F95B5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
AAF9817A5E4059C99E5D2E966D2EDE8E.text	AAF9817A5E4059C99E5D2E966D2EDE8E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dobrisimastigomycetes Tedersoo	<div><p>Dobrisimastigomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Dobrisimastigales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 1 (positions 124–138 in the type species and 122–136 in S. cerevisiae tgggtaggttacctg; three mismatches allowed). Forms a monophyletic, least inclusive clade in Neocallimastigomycota, covering sequences EUK 1189296, EUK 1138904, EUK 0534669, EUK 0534670, and EUK 0534680 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Labelled as clade GS 93 B in EUKARYOME v 1.9. Currently harbors Dobrisimastigales (ord. nov.). Comprises 10–12 species. Detected in soil (91.7 % out of 36 records) and sediments (8.3 %) in tundra to tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/AAF9817A5E4059C99E5D2E966D2EDE8E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
5851DC3496435533AA1BB3D9852890C2.text	5851DC3496435533AA1BB3D9852890C2.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dobrisimastix Tedersoo 2025	<div><p>Dobrisimastix Tedersoo gen. nov.</p><p>Type species.</p><p>Dobrisimastix vlkii Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 2–18 in type species taaaatrtcacaaccac; one mismatch allowed), SSU V 4 (positions 700–719 in S. cerevisiae ctggtgaatcatcgtgctct; no mismatch allowed), LSU D 1 (positions 124–138 in the type species and 122–136 in S. cerevisiae tgggtaggttacctg; one mismatch allowed), and LSU D 2 (positions 507–526 in type species and 452–471 in S. cerevisiae tgtataagaggcttcgcttg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Dobrisimastigaceae, covering sequences EUK 1189296, EUK 1138904, EUK 0534669, EUK 0534670, and EUK 0534680 (Figs 1, 21).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Harbors 10–12 potential species represented by sequences EUK 1138904 (forest soil in New Zealand), EUK 0534669 (forest soil in Guatemala), EUK 0534670 (forest soil in Colombia), EUK 0534680 (forest soil in Colombia), EUK 0534676 (greenhouse soil in Estonia), EUK 0534677 (forest soil in Mexico), and EUK 0534667 (forest soil in Tanzania).</p></div>	https://treatment.plazi.org/id/5851DC3496435533AA1BB3D9852890C2	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
F78E705D5FAE5C63B2DDBA25C603BD81.text	F78E705D5FAE5C63B2DDBA25C603BD81.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dobrisimastix vlkii Tedersoo 2025	<div><p>Dobrisimastix vlkii Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Dobrisimastix based on ITS 2 (positions 85–104 tgcctggttgtctaactata; one mismatch allowed) and LSU D 2 (positions 477–496 ttaattcttcgaccgcaagg; one mismatch allowed) as indicated in Fig. 22. Intraspecific variation up to 1.5 % in ITS 2. Interspecific distance at least 8.4 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 003459 (holotype); eDNA sequence EUK 1189296 = OZ 253796 (legitype); eDNA sample TUE 103459 (nucleotype); GSMc plot S 961, temperate deciduous forest in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=14.1815&amp;materialsCitation.latitude=49.7776" title="Search Plazi for locations around (long 14.1815/lat 49.7776)">Dobříš</a>, Czechia, 49.7776°N, 14.1815°E .</p><p>Description.</p><p>Other sequences: EUK 0332259 (GSMc plot S 947, boreal forest soil in Malyi Tigirek, Altai, Russian Federation, 51.1247°N, 83.0368°E); EUK 0332261 (GSMc plot S 149, temperate Pinus forest soil in Stanislaus, CA, USA, 37.8138, –119.8926); EUK 0332264 (GSMc plot IH. ME 29, temperate Fagus orientalis forest soil in Mestia, Georgia, 42.9764°N, 42.5429°E); EUK 0332267 (GSMc plot G 2629, temperate mixed forest soil in Nigula, Estonia, 58.0458°N, 24.7119°E); EUK 0534684 (GSMc plot S 431, Arctic tundra soil in Toolik Lake, AK, USA, 68.622, –149.5977); EUK 0584891 (FunAqua sediment sample W 0220 s, Triefenbach, Germany, 49.2812°N, 8.1135°E); and EUK 0584892 (FunAqua sediment sample W 0525 s, Novaki, Croatia, 45.6573°N, 15.6345°E).</p><p>Etymology.</p><p>Dobříš (Czech) and mastix (Greek) refer to the type locality and Neocallimastix, respectively, and Vlk (Czech) refers to Lukáš Vlk, who collected the type material.</p><p>Notes.</p><p>Found in soil samples (88.9 %) and sediments of lakes (11.1 %) in tundra to warm temperate forests in the Northern Hemisphere (n = 18 localities). GlobalFungi reveals 227 additional records in soil (91.6 %), roots (5.7 %), and sediments (1.3 %) in Europe, North America, and Asia, with occasional findings from tropical forests in Kenya and South America.</p></div>	https://treatment.plazi.org/id/F78E705D5FAE5C63B2DDBA25C603BD81	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
FF8CD3CAC7EB570BB1830EEB07F80A1A.text	FF8CD3CAC7EB570BB1830EEB07F80A1A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Edaphochytriaceae Tedersoo 2025	<div><p>Edaphochytriaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Edaphochytrium Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in the LSU 5 ’ end (positions 15–24 in the type species and S. cerevisiae tagtggacta or tgatggacta; one mismatch allowed). Forms a monophyletic, least inclusive clade in Edaphochytriales, covering sequences EUK 1008462, EUK 1200051, EUK 1123749, EUK 1630709, EUK 1123746, EUK 1200763, and EUK 1123748 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Edaphochytrium (gen. nov.) and other potentially genus-level groups represented by sequences EUK 1123749 and EUK 1008462.</p></div>	https://treatment.plazi.org/id/FF8CD3CAC7EB570BB1830EEB07F80A1A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
31016709247B5E029EDC2234BA66CA96.text	31016709247B5E029EDC2234BA66CA96.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Edaphochytriales Tedersoo 2025	<div><p>Edaphochytriales Tedersoo ord. nov.</p><p>Type family.</p><p>Edaphochytriaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 45–64 catagtgaaatgtgataact in type species and S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Edaphochytriomycetes, covering sequences EUK 1671450, EUK 1671451, EUK 1008462, EUK 1200051, EUK 1101631, EUK 1101779, EUK 1123746, EUK 1200763, and EUK 1123748 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Edaphochytriaceae (fam. nov.) and other potentially family-level groups represented by sequences EUK 1671450 (forest soil in Guadeloupe), EUK 1101631 (permafrost in Canada), EUK 1101779 (cropland soil in Great Britain), and EUK 1671451 (shrubland soil in Morocco).</p></div>	https://treatment.plazi.org/id/31016709247B5E029EDC2234BA66CA96	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
803D1E66296251A0AA026341AEFC1E66.text	803D1E66296251A0AA026341AEFC1E66.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Edaphochytriomycetes Tedersoo	<div><p>Edaphochytriomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Edaphochytriales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 45–64 in type species and S. cerevisiae catagtgaaatgtgataact or catggtgaaatgtgacaatt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chytridiomycota, covering sequences EUK 1104126, EUK 1107474, EUK 1671450, EUK 1671451, EUK 1008462, EUK 1200051, EUK 1101631, EUK 1101779, EUK 1200763, and EUK 1123748 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 42 in EUKARYOME v 1.9. Currently harbors Edaphochytriales (ord. nov.) and potentially an order-level group represented by sequences EUK 1104126 (lake water in Sweden) and EUK 1107474 (peatland soil in Sweden). Comprises potentially 40–45 species. Detected in soil (94.4 % out of the 89 records), sediments (2.2 %), glacial ice (2.2 %), and freshwater (1.1 %) in tundra to wet tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/803D1E66296251A0AA026341AEFC1E66	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
743523EEA3FD58E79B138FA3F9184DF6.text	743523EEA3FD58E79B138FA3F9184DF6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Edaphochytrium Tedersoo 2025	<div><p>Edaphochytrium Tedersoo gen. nov.</p><p>Type species.</p><p>Edaphochytrium valuojaense Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 114–133 in type species and S. cerevisiae cagtctcttaaggagataat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Edaphochytriaceae, covering sequences EUK 1200051, EUK 1630709, EUK 1200763, and EUK 1123748 (Figs 1, 8).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially 4–5 species represented by sequences EUK 1200051 (forest soil in Estonia), EUK 1630709 (forest soil in Estonia), and EUK 0133658 (plantation soil in the Canary Islands).</p></div>	https://treatment.plazi.org/id/743523EEA3FD58E79B138FA3F9184DF6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3CBD05F11A47576B918D75F77FA7B862.text	3CBD05F11A47576B918D75F77FA7B862.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Edaphochytrium valuojaense Tedersoo 2025	<div><p>Edaphochytrium valuojaense Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Edaphochytrium based on ITS 2 (positions 99–118 tttctataatatttttgaca; one mismatch allowed) and LSU (positions 614–633 tgagatatttctgatttttg; one mismatch allowed) as indicated in Fig. 9. Intraspecific variation up to 2.1 % in ITS 2 and up to 0.6 % in LSU. Interspecific distance at least 11.8 % in ITS 2 and 6.9 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 001432 (holotype); eDNA sequence EUK 1123748 = OZ 253789 (legitype); eDNA sample TUE 101432 (nucleotype); GSMc plot G 4257 z, Salix fragilis grove soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=25.5859&amp;materialsCitation.latitude=58.3643" title="Search Plazi for locations around (long 25.5859/lat 58.3643)">Valuoja park</a>, Viljandi, Estonia, 58.3643°N, 25.5859°E .</p><p>Description.</p><p>Other sequences: EUK 0133766 (GSMc plot G 3522, temperate deciduous forest soil in Pidula, Estonia, 58.4211°N, 22.1522°E); EUK 0474798 ( Populus × wettsteinii plantation soil in Nõgiaru, Estonia, 58.3262°N, 26.5545°E); and OU 941982 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E).</p><p>Etymology.</p><p>Edaphos (Greek) refers to ground, and Valuoja (Estonian) refers to the type locality.</p><p>Notes.</p><p>Found in soil across contrasting habitats in Estonia and Sweden (n = 4 records). GlobalFungi reveals an additional 35 records in European soils and two records in US soils, nearly all in cropland and grassland habitats.</p></div>	https://treatment.plazi.org/id/3CBD05F11A47576B918D75F77FA7B862	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
789DCE7E9D365502A642775FB1F8B674.text	789DCE7E9D365502A642775FB1F8B674.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Fungi R. T. Moore	<div><p>Fungi R. T. Moore Botanica Marina 23 (6): 371 (1980)</p><p>Type phylum.</p><p>None.</p><p>Description.</p><p>As in Moore (1980).</p><p>Notes.</p><p>Currently harbors the subkingdoms Aphelidiomyceta, Blastocladiomyceta, Chytridiomyceta, Dikarya, Mucoromyceta, Olpidiomyceta, Rozellomyceta, Zoopagomyceta, and Tartumyceta (subreg. nov).</p></div>	https://treatment.plazi.org/id/789DCE7E9D365502A642775FB1F8B674	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
B148F9AE45E45E2A927A7BCA24039FC6.text	B148F9AE45E45E2A927A7BCA24039FC6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gelotisporidiaceae Tedersoo 2025	<div><p>Gelotisporidiaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Gelotisporidium Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 613–627 in type species and 692–696 in S. cerevisiae cccttgggcgcaaag; one mismatch allowed). Forms a monophyletic, least inclusive clade in Gelotisporidiales, covering sequences EUK 1138568, EUK 1138757, EUK 1100418, EUK 1138778, EUK 1202629, EUK 1201985, EUK 1104844, EUK 1101158, and EUK 1123671 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Gelotisporidium and several genus-level groups represented by sequences EUK 1138568 (forest soil in New Zealand), EUK 1138757 (forest soil in New Zealand), EUK 1100418 (permafrost in Canada), EUK 1138778 (forest soil in New Zealand), EUK 1202629 (forest soil in Finland), and EUK 1123671 (forest soil in Estonia).</p></div>	https://treatment.plazi.org/id/B148F9AE45E45E2A927A7BCA24039FC6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
4EC045F186215E86A344A54F79E587B4.text	4EC045F186215E86A344A54F79E587B4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gelotisporidiales Tedersoo 2025	<div><p>Gelotisporidiales Tedersoo ord. nov.</p><p>Type family.</p><p>Gelotisporidiaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1541–1550 in S. cerevisiae ggatcagtca; no mismatch allowed) and LSU D 1 (positions 302–311 in the type species and 305–314 in S. cerevisiae cgcgccatct; one mismatch allowed). Forms a monophyletic, least inclusive clade in Gelotisporidiomycetes, covering sequences EUK 1138731, EUK 1138718, EUK 1138568, EUK 1138757, EUK 1100925, EUK 1105586, EUK 1105726, EUK 1105789, EUK 1101184, EUK 1202629, EUK 1201985, EUK 1104844, and EUK 1123671 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Gelotisporidiaceae (fam. nov.) and other potentially family-level groups represented by sequences EUK 1100925 (unspecified soil in Tibet), EUK 1105586 (lake water in Sweden), EUK 1105726 (forest soil in Sweden), and EUK 1105789 (forest soil in Sweden).</p></div>	https://treatment.plazi.org/id/4EC045F186215E86A344A54F79E587B4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
844911DB3E0F52D7945DEB9DC375F6EB.text	844911DB3E0F52D7945DEB9DC375F6EB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gelotisporidiomycetes Tedersoo	<div><p>Gelotisporidiomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Gelotisporidiales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1541–1550 in S. cerevisiae ggatcagtca; no mismatch allowed) and LSU D 1 (positions 302–311 in type species and 305–314 in S. cerevisiae cgcgccatct; one mismatch allowed). Forms a monophyletic, least inclusive clade in Rozellomycota, covering sequences EUK 1138731, EUK 1138718, EUK 1138568, EUK 1138757, EUK 1100925, EUK 1105586, EUK 1105726, EUK 1105789, EUK 1101184, EUK 1202629, EUK 1201985, EUK 1104844, and EUK 1123671 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 15 in EUKARYOME v 1.9. Previously considered a lineage with phylogenetic affinities to Blastocladiomycota, but inclusive taxon sampling in Blastocladiomycota and Rozellomycota places Gelotisporidiomycetes in Rozellomycota . Currently harbors Gelotisporidiales (ord. nov.). Comprises potentially 90–110 species. Detected in soil (96.7 % out of 335 records) and freshwater (2.7 %). Two samples were identified from myxomycete colonies, suggesting that this group may include protist parasites. Recorded from tundra to hot tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/844911DB3E0F52D7945DEB9DC375F6EB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
B8D340E73DEB58D2980EF95EDC245443.text	B8D340E73DEB58D2980EF95EDC245443.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gelotisporidium boreale Tedersoo 2025	<div><p>Gelotisporidium boreale Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Gelotisporidiaceae based on ITS 2 (positions 111–130 ggcaagcccaaccgggagta; one mismatch allowed) and LSU (positions 481–500 gagttgtgtcacatatagca; one mismatch allowed) as indicated in Fig. 44. Intraspecific variation up to 4.7 % in ITS 2 and up to 1.0 % in LSU. Interspecific distance&gt; 15 % in ITS 2 and&gt; 10 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 000189 (holotype); eDNA sequence EUK 1201985 = OZ 253809 (legitype); eDNA sample TUE 100189 (nucleotype); GSMc plot G 2836, Betula spp. dominated tundra soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=21.7452&amp;materialsCitation.latitude=68.6035" title="Search Plazi for locations around (long 21.7452/lat 68.6035)">Gelotjávri</a>, Finland, 68.6035°N, 21.7452°E .</p><p>Description.</p><p>Other sequences: EUK 1101158 (coniferous forest soil in Hofors, Sweden, 60.49°N, 16.3°E); EUK 0325837 (GSMc plot S 1124, mixed forest soil in Zavodoukovskiy, Tyumen Oblast, Russian Federation, 56.5299°N, 66.5028°E); EUK 0473501 (GSMc plot IHPR 02, Betula pubescens tundra soil in Stora Sjöfallet, Sweden, 67.6367°N, 17.8216°E); EUK 0325836 ( Betula pubescens tundra soil at Lake Sobach’ye, Krasnoyarsk Krai, Russian Federation, 69.0033°N, 90.9875°E); and EUK 0325821 (GSMc plot S 1081, Araucaria araucana forest soil in Nahuelbuta, Chile, – 37.7897, – 73.0034°E).</p><p>Etymology.</p><p>Gelot (Sámi) refers to the type locality at Gelotjávri (Kelottijärvi), and boreale (Latin) refers to the mainly boreal habitat of the species.</p><p>Notes.</p><p>Found in 40 soil samples in boreal and subarctic habitats in Fennoscandia, the Northern Russian Federation, and Alaska, and once in the Chilean highlands (has unique substitutions). The 27 additional GlobalFungi records indicate habitat in soil and dead wood (11.1 %) and distribution in the Holarctic realm.</p></div>	https://treatment.plazi.org/id/B8D340E73DEB58D2980EF95EDC245443	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
FCE220F032B354699805B7C9B8AD4896.text	FCE220F032B354699805B7C9B8AD4896.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Gelotisporidium Tedersoo 2025	<div><p>Gelotisporidium Tedersoo gen. nov.</p><p>Type species.</p><p>Gelotisporidium boreale Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1699–1718 in S. cerevisiae acccgtctttcgttg; one mismatch allowed) and 5.8 S-ITS 2 (positions starting from 151 in type species and 153 in S. cerevisiae agaattgaaa; one mismatch allowed). Forms a monophyletic, least inclusive clade in Gelotisporidiaceae, covering sequences EUK 1201985 and EUK 1101158 (Figs 1, 43).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises Gelotisporidium boreale (sp. nov.).</p></div>	https://treatment.plazi.org/id/FCE220F032B354699805B7C9B8AD4896	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
17801D1CD81554A2A913A227945F743E.text	17801D1CD81554A2A913A227945F743E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Kickxellomycota Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Kickxellomycota Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 150 (2018)</p><p>Type class.</p><p>Kickxellomycetes Tedersoo, Sánchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov .</p><p>Description.</p><p>As in Tedersoo et al. 2018.</p><p>Notes.</p><p>Kickxellomycota currently harbors Asellariomycetes, Barbatosporomycetes, Dimargaritomycetes, Harpellomycetes, Kickxellomycetes, Ramicandelaberomycetes, and Parakickxellomycetes (class. nov.).</p></div>	https://treatment.plazi.org/id/17801D1CD81554A2A913A227945F743E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
235650E026F052209505EBB267468D4A.text	235650E026F052209505EBB267468D4A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Maerjamyces jumpponenii Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Maerjamyces jumpponenii Tedersoo &amp; Esmaeilzadeh-Salestani sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Maerjamyces based on ITS 2 (positions 43–75 atacctgtttgagtaccatattcttttcccttt; one mismatch allowed) and LSU D 1 (positions 233–252 ttgcactcgtgggttatgta; one mismatch allowed) as indicated in Fig. 34. Intraspecific variation up to 5.4 % in ITS 2 and up to 1.6 % in LSU. Closest species differ by at least 7.4 % in ITS 2 and 5.0 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 002272 (holotype); eDNA sequence EUK 1138158 = OZ 253803 (legitype); eDNA sample TUE 102272 (nucleotype); GSMc plot G 5295, Pinus mugo plantation soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.6443&amp;materialsCitation.latitude=58.3592" title="Search Plazi for locations around (long 26.6443/lat 58.3592)">Märja</a>, Estonia, 58.3592°N, 26.6443°E .</p><p>Description.</p><p>Other sequences: EUK 1138156 (GSMc plot G 5235, Larix decidua plantation soil in Rõõmu, Estonia, 58.3835°N, 26.7742°E); EUK 1138160 (GSMc plot G 5803, urban park soil in Toomemägi, Estonia, 58.3786°N, 26.7185°E); EUK 1138157 (GSMc plot G 5283, Quercus robur plantation in Rahinge, Estonia, 58.3845°N, 26.5943°E); MT 277862 (book paper in Turin, Italy); OU 939288 (Kungsängen, Sweden, 59.837°N, 17.661°E); (GSMc plot G 4800, Ulmus laevis forest soil in Tuhkja, Estonia, 58.4159°N, 25.2326°E); and EUK 1138159 (urban soil in Tartu, Estonia, 58.3913°N, 26.6965°E).</p><p>Etymology.</p><p>Maerjamyces refers to the type locality in Märja (Estonian), and mykos (Greek) stands for a fungus; Jumpponen (Finnish) refers to Ari Jumpponen, who was the first to collect material of this species (FJ 780627; Jumpponen et al. 2010).</p><p>Notes.</p><p>Found mainly in soil (90.4 %) but also from sediments, water, and paper samples (260 total records). Occurs on all continents, but&gt; 95 % of records originate from the temperate and Mediterranean biomes of the Northern Hemisphere. Out of 244 GlobalFungi records, 98.4 % are derived from soil.</p></div>	https://treatment.plazi.org/id/235650E026F052209505EBB267468D4A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2A849F7A1A0A57279854362E7BD51733.text	2A849F7A1A0A57279854362E7BD51733.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Maerjamyces Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Maerjamyces Tedersoo &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Maerjamyces jumpponenii Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 77–86 in type species and 78–87 in S. cerevisiae agagtacgtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Maerjamycetaceae, covering sequences EUK 1138158, EUK 0484301, and EUK 0484311 (Figs 1, 33).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially three species, represented by sequences EUK 0484301 (tundra soil in Svalbard) and EUK 0484311 (forest soil in OR, USA).</p></div>	https://treatment.plazi.org/id/2A849F7A1A0A57279854362E7BD51733	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2432328FB50A56228BD7D02B31126714.text	2432328FB50A56228BD7D02B31126714.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Maerjamycetaceae Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Maerjamycetaceae Tedersoo &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Maerjamyces Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 77–86 in type species and 78–87 in S. cerevisiae agagtacgtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Maerjamycetales, covering sequences EUK 1138158, EUK 0484301, and EUK 0484311 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Maerjamycetaceae is currently monogeneric.</p></div>	https://treatment.plazi.org/id/2432328FB50A56228BD7D02B31126714	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
9773BE4E95645CC98079EE6582AC5F4B.text	9773BE4E95645CC98079EE6582AC5F4B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Maerjamycetales Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Maerjamycetales Tedersoo &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Maerjamycetaceae Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1684–1690 in S. cerevisiae gatgcat; no mismatch allowed) and LSU D 1 (positions 114–122 in type species and 115–123 in S. cerevisiae cactttctg; no mismatch allowed). Forms a monophyletic, least inclusive clade in Maerjamycetes, covering sequences EUK 1200032, EUK 1217336, EUK 1009005, EUK 0484311, EUK 0484301, and EUK 1138158 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Maerjamycetaceae (fam. nov.) and another potentially family-level group represented by sequences EUK 1200032, EUK 1217336, and EUK 1009005 (all forest soil in Estonia).</p></div>	https://treatment.plazi.org/id/9773BE4E95645CC98079EE6582AC5F4B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
D8D9CB6817E6564FB7D0E91E00A1A572.text	D8D9CB6817E6564FB7D0E91E00A1A572.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Maerjamycetes Tedersoo & Esmaeilzadeh-Salestani	<div><p>Maerjamycetes Tedersoo &amp; Esmaeilzadeh-Salestani class. nov.</p><p>Type order.</p><p>Maerjamycetales Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1684–1690 in S. cerevisiae gatgcat; no mismatch allowed) and LSU D 1 (positions 114–122 in type species and 115–123 in S. cerevisiae cactttctg; no mismatch allowed). Forms a monophyletic, least inclusive clade in Mortierellomycota, covering sequences EUK 1200032, EUK 1217336, EUK 1009005, EUK 0484311, EUK 0484301, and EUK 1138158 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 48 in EUKARYOME v 1.9. Currently harbors Maerjamycetales (ord. nov.). Comprises around five species. Detected in soil (90.6 % out of the 276 records), sediments (7.6 %), water (1.1 %), and old paper (0.7 %) in high arctic to hot tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/D8D9CB6817E6564FB7D0E91E00A1A572	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
0B9123C4B23D5826B6981673656AA253.text	0B9123C4B23D5826B6981673656AA253.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mirabilomyces abrukanus Tedersoo & R. H. Nilsson 2025	<div><p>Mirabilomyces abrukanus Tedersoo &amp; R. H. Nilsson sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Mirabilomyces based on ITS 2 (positions 68–87 cttcggttwtaaaacaaggt; two mismatches allowed) and LSU (positions 534–553 ctacgctgtggttgcgcttt; one mismatch allowed) as indicated in Fig. 54. Intraspecific variation up to 11.4 % in ITS 2 due to length polymorphism in multiple mono- and dinucleotide repeats and up to 1.0 % in LSU. Interspecific distance&gt; 20 % in ITS 2 and at least 6.0 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 000464 (holotype); eDNA sequence EUK 1200676 = OZ 253813 (legitype); eDNA sample TUE 100464 (nucleotype); GSMc plot S 208, Tilia cordata temperate forest soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=22.5004&amp;materialsCitation.latitude=58.1568" title="Search Plazi for locations around (long 22.5004/lat 58.1568)">Abruka</a>, Estonia, 58.1568°N, 22.5004°E .</p><p>Description.</p><p>Other sequences: EUK 0483305 (temperate broadleaf forest soil in Arcais, France, 46.3038, – 0.6844°E); EUK 1124377 (GSMc plot G 5235, Larix decidua plantation soil in Rõõmu, Estonia, 58.3835°N, 26.7742°E); EUK 1216948 (GSMc plot G 4777, flooded grassland soil in Suur-Pakri Härs-hämani, Estonia, 59.3310°N, 23.9272°E); EUK 1216949 (GSMc plot G 4679, Salix triandra wetland soil in Prangli Rivimaa, Estonia, 59.6150°N, 24.9871°E); OU 939561 (grassland soil in Kungsängen, Sweden, 59.837°N, 17.661°E); EUK 1202060 (GSMc plot G 4747, Prunus-Rhamnus-Euonymus forest soil in Tsirgumäe, Estonia, 57.5942°N, 26.3241°E); EUK 1216950 (GSMc plot G 4742, Fraxinus-Ulmus forest soil in Lüütre, Estonia, 58.1444°N, 25.2628°E); and EUK 1216946 (GSMc plot S 1366, temperate grassland soil in Innhavet, Norway, 67.9676°N, 15.9277°E).</p><p>Etymology.</p><p>Mirabilis (Latin) refers to the remarkable and astonishing finding of a large, unrecognized fungal lineage, and Abruka (Estonian) refers to the type locality of the species.</p><p>Notes.</p><p>Found in grassland and forest soils in North and Central Europe (n = 57 records), with single records from Asia, North America, and Africa. GlobalFungi reveals no additional information.</p></div>	https://treatment.plazi.org/id/0B9123C4B23D5826B6981673656AA253	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
B3FE3A94FDA15C71A66A46D7D33132EC.text	B3FE3A94FDA15C71A66A46D7D33132EC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mirabilomyces Tedersoo & R. H. Nilsson 2025	<div><p>Mirabilomyces Tedersoo &amp; R. H. Nilsson gen. nov.</p><p>Type species.</p><p>Mirabilomyces abrukanus Tedersoo &amp; R. H. Nilsson .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 205–214 cttgattagt in type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Mirabilomycetaceae, covering sequences EUK 1200676 and EUK 1124366 (Figs 1, 53).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises 170–200 potential species represented by sequences EUK 1201728 (forest soil in Estonia), EUK 1124366 (grassland soil in Estonia), EUK 1101799 (forest soil in Puerto Rico), EUK 1101831 (forest soil in Puerto Rico), EUK 1101652 (forest soil in Puerto Rico), EUK 1101776 (forest soil in Puerto Rico), and OU 943050 (grassland soil in Sweden).</p></div>	https://treatment.plazi.org/id/B3FE3A94FDA15C71A66A46D7D33132EC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
486765941E595DEAA5C8315E1C70D389.text	486765941E595DEAA5C8315E1C70D389.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mirabilomycetaceae Tedersoo & R. H. Nilsson 2025	<div><p>Mirabilomycetaceae Tedersoo &amp; R. H. Nilsson fam. nov.</p><p>Type genus.</p><p>Mirabilomyces Tedersoo &amp; R. H. Nilsson .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in the LSU 5 ’ end (positions 1–11 in the type species and S. cerevisiae tcattctcaac; one mismatch allowed) and ITS 2 (positions 196–208 in type species aacaatgacttga; one mismatch allowed). Forms a monophyletic, least inclusive clade in Mirabilomycetales, covering sequences EUK 1200676, EUK 1201256, EUK 1203033, EUK 1201246, EUK 1201583, EUK 1201728, and EUK 1124366 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Mirabilomyces (gen. nov.) and other potentially genus-level groups represented by sequences EUK 1201256 (grassland soil in Switzerland), EUK 1203033 (forest soil in the Canary Islands), EUK 1201246 (forest soil in Estonia), and EUK 1201583 (grassland soil in Norway).</p></div>	https://treatment.plazi.org/id/486765941E595DEAA5C8315E1C70D389	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
DF6AA243BEE95033B233F98BE284745B.text	DF6AA243BEE95033B233F98BE284745B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mirabilomycetales Tedersoo & R. H. Nilsson	<div><p>Mirabilomycetales Tedersoo &amp; R. H. Nilsson</p><p>Type family.</p><p>Mirabilomycetaceae Tedersoo &amp; R. H. Nilsson .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in the LSU 5 ’ end (positions 1–11 in the type species and S. cerevisiae tcattctcaac or cggatctcaaa; one mismatch allowed). Forms a monophyletic, least inclusive clade in Mirabilomycetes, covering sequences EUK 1100742, EUK 1204083, EUK 1200757, EUK 1201873, EUK 1211619, EUK 1200676, EUK 1201256, EUK 1203033, EUK 1201246, and EUK 1201583 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Mirabilomycetaceae (fam. nov.) and other potentially family-level groups represented by sequences EUK 1100742 (unspecified soil in Tibet), EUK 1204083 (tundra soil in Norway), EUK 1200757 (grassland soil in Italy), EUK 1201873 (forest soil in Estonia), and EUK 1211619 (grassland soil in Italy).</p></div>	https://treatment.plazi.org/id/DF6AA243BEE95033B233F98BE284745B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
47A202E2D65550928B857154A032CC2A.text	47A202E2D65550928B857154A032CC2A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mirabilomycetes Tedersoo & R. H. Nilsson	<div><p>Mirabilomycetes Tedersoo &amp; R. H. Nilsson class. nov.</p><p>Type order.</p><p>Mirabilomycetales Tedersoo &amp; R. H. Nilsson .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 102–109 cttgaaat in the type species; one mismatch allowed). Forms a monophyletic, least inclusive clade in Mirabilomycota, covering sequences EUK 1100742, EUK 1204083, EUK 1200757, EUK 1201873, EUK 1211619, EUK 1200676, EUK 1201256, EUK 1203033, EUK 1201246, EUK 1201583, EUK 1107008, EUK 1110728, EUK 1109741, EUK 1201657, EUK 1109988, EUK 1108787, and EUK 1115028 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently harbors Mirabilomycetales and potentially order-level groups represented by sequences EUK 1107008 (forest soil in Puerto Rico), EUK 1110728 (forest soil in Sweden), EUK 1109741 (forest soil in Puerto Rico), EUK 1201657 (forest soil in Estonia), EUK 1109988 (forest soil in Puerto Rico), EUK 1108787 (cropland soil in Great Britain), and EUK 1115028 (unspecified soil in Tibet).</p></div>	https://treatment.plazi.org/id/47A202E2D65550928B857154A032CC2A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
E44AF40A0E805AEC979E81E0192B894D.text	E44AF40A0E805AEC979E81E0192B894D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mirabilomycota Tedersoo & R. H. Nilsson 2025	<div><p>Mirabilomycota Tedersoo &amp; R. H. Nilsson phyl. nov.</p><p>Type class.</p><p>Mirabilomycetes Tedersoo &amp; R. H. Nilsson .</p><p>Diagnosis.</p><p>Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 1101676, EUK 1107181, EUK 1103059, EUK 1100023, EUK 1103883, EUK 1102753, EUK 1100742, EUK 1204083, EUK 1200757, EUK 1201873, EUK 1211619, EUK 1200676, EUK 1201256, EUK 1203033, EUK 1201246, EUK 1201583, EUK 1107008, EUK 1110728, EUK 1109741, EUK 1201657, EUK 1109988, EUK 1108787, and EUK 1115028 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 41 in EUKARYOME v 1.9. There are no diagnostic nucleotide signatures to distinguish them from other fungi due to rapid rRNA gene evolution in certain class- and order-level groups. Currently harbors Mirabilomycetes (class. nov) and potentially class-level groups represented by sequences EUK 1101676 (forest soil in Puerto Rico), EUK 1107181 (forest soil in Puerto Rico), EUK 1103059 (forest soil in Puerto Rico), EUK 1100023 (forest soil in Sweden), EUK 1103883 (forest soil in Puerto Rico), and EUK 1102753 (forest soil in Puerto Rico). Comprises potentially 1500–1800 species. Detected in soil (99.9 % out of 6193 records) and sediments (0.1 %) in tundra to wet tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/E44AF40A0E805AEC979E81E0192B894D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3122B554E8DA561AAC345C45238AC500.text	3122B554E8DA561AAC345C45238AC500.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Monoblepharomycota Doweld	<div><p>Monoblepharomycota Doweld, Prosyllabus Tracheophytorum, Tentamen systematis plantarum vascularium (Tracheophyta): LXXVII (2001)</p><p>Type class.</p><p>Monoblepharidomycetes J. H. Schaffner.</p><p>Description.</p><p>As in Schaffner (1909).</p><p>Notes.</p><p>Monoblepharomycota currently harbors Hyaloraphidiomycetes, Monoblepharidomycetes, and Algovoracomycetes (class. nov.).</p></div>	https://treatment.plazi.org/id/3122B554E8DA561AAC345C45238AC500	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
D5EDF9C6663F522A9FBC3CDDFCEFCC7A.text	D5EDF9C6663F522A9FBC3CDDFCEFCC7A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mortierellomycetes Doweld	<div><p>Mortierellomycetes Doweld Index Fungorum 46: 1 (2014)</p><p>Type order.</p><p>Mortierellales Caval.-Sm.</p><p>Description.</p><p>As in Doweld (2014).</p><p>Notes.</p><p>Currently harbors Mortierellales and Mycosocceriales (ord. nov.).</p></div>	https://treatment.plazi.org/id/D5EDF9C6663F522A9FBC3CDDFCEFCC7A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
442E84212AC559A5BD6DA20D463FBDC3.text	442E84212AC559A5BD6DA20D463FBDC3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mortierellomycota Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Mortierellomycota Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 152 (2018)</p><p>Type class.</p><p>Mortierellomycetes Doweld .</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Currently harbors Mortierellomycetes, Maerjamycetes (class. nov.), and Ruderaliomycetes (class. nov.).</p></div>	https://treatment.plazi.org/id/442E84212AC559A5BD6DA20D463FBDC3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
9AAB646EF816588A9ADF4674F62EE7BE.text	9AAB646EF816588A9ADF4674F62EE7BE.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mucoromycota Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Mucoromycota Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 151 (2018)</p><p>Type phylum.</p><p>Mucoromycota Doweld .</p><p>Description.</p><p>As in Tedersoo et al. (2018)</p><p>Notes.</p><p>Currently harbors Calcarisporiellomycota, Glomeromycota, Mucoromycota, Mortierellomycota, and Curlevskiomycota (phyl. nov.).</p></div>	https://treatment.plazi.org/id/9AAB646EF816588A9ADF4674F62EE7BE	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
F1A3F5560B4B522CB7E6A5F769B5FBDE.text	F1A3F5560B4B522CB7E6A5F769B5FBDE.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mycosocceria estonica Tedersoo, Bahram & Esmaeilzadeh-Salestani 2025	<div><p>Mycosocceria estonica Tedersoo, Bahram &amp; Esmaeilzadeh-Salestani sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Mycosocceria based on ITS 2 (positions 338–357 agaactttgttctttttaac; one mismatch allowed) and LSU D 2 (positions 466–485 aatctggtcccggtggatgg; one mismatch allowed) as indicated in Fig. 32. Intraspecific variation up to 2.3 % in ITS 2 and 0.2 % in LSU. Interspecific distance at least 10.2 % in ITS 2 and 10.3 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 028391 (holotype); eDNA sequence EUK 1124462 = OZ 253802 (legitype); eDNA sample TUE 128391 (nucleotype); GSMc plot G 5802, football field in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.6855&amp;materialsCitation.latitude=58.3745" title="Search Plazi for locations around (long 26.6855/lat 58.3745)">Veeriku</a>, Estonia, 58.3745°N, 26.6855°E .</p><p>Description.</p><p>Other sequences: EUK 1603994 (GSMc plot G 5816, Trifolium pratense cropland soil in Hermani, Estonia, 58.8071°N, 25.7564°E); EUK 1008618 (GSMc plot G 4599, Ulmus laevis forest soil in Liutsepa, Estonia, 58.0791°N, 26.0094°E); EUK 0331576 (GSMc plot G 5820, Acer - Fraxinus - Ulmus woodland soil in Pajusi, Estonia, 58.7052°N, 25.9389°E); EUK 0331575 (GSMc plot G 5422, Pinus strobus woodland soil in Tartu, Estonia, 58.3909°N, 26.6973°E); EUK 0331574 (GSMc plot G 5765 y, grassland soil in Rebaste, Estonia, 58.41°N, 25.93°E); EUK 0331573 (urban park soil in Slovenia); and EUK 0331572 (GSMc plot S 950, forest tundra soil in Mt. Mayak, Altai kray, Russian Federation, 51.0474°N, 82.9718°E).</p><p>Etymology.</p><p>Soccer (English) refers to the football field where the type specimen was collected; and estonica (Latin) refers to Estonia, where this species’ type and most additional materials originate.</p><p>Notes.</p><p>All but one of the 40 records and all five GlobalFungi records are derived from soil. Found mainly in North Eurasia, with occasional records elsewhere.</p></div>	https://treatment.plazi.org/id/F1A3F5560B4B522CB7E6A5F769B5FBDE	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
79531C1D48A15E80BC7764DCEEF403F5.text	79531C1D48A15E80BC7764DCEEF403F5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mycosocceria Tedersoo, Bahram & Esmaeilzadeh-Salestani 2025	<div><p>Mycosocceria Tedersoo, Bahram &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Mycosocceria estonica Tedersoo, Bahram &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other species of fungi based on diagnostic nucleotide signatures in 5.8S (positions 120–129 in type species and S. cerevisiae cccggtaggc). Forms a monophyletic, least inclusive clade in Mycosocceriaceae, covering sequences EUK 1008618, EUK 0531631, and EUK 1124462 (Figs 1, 31).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes M. estonica and another species represented by sequence EUK 0531631 (savanna soil in Uganda).</p></div>	https://treatment.plazi.org/id/79531C1D48A15E80BC7764DCEEF403F5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
0082E1A2F1215F05BEC5A7528320CB27.text	0082E1A2F1215F05BEC5A7528320CB27.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mycosocceriaceae Tedersoo, Bahram & Esmaeilzadeh-Salestani 2025	<div><p>Mycosocceriaceae Tedersoo, Bahram &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Mycosocceria Tedersoo, Bahram &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other species of Mortierellomycetes based on diagnostic nucleotide signatures in SSU V 9 (positions 1654–1663 in S. cerevisiae gattgaacgg; no mismatch allowed), 5.8S (positions 90–99 in type species and S. cerevisiae tcatcaaatc; no mismatch allowed), and LSU D 2 (positions 573–592 in type species and 521–540 in S. cerevisiae aagttggaggaatgtggctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Mycosocceriales, covering sequences EUK 0531595, EUK 1102426, EUK 1202279, EUK 0531631, EUK 1008618, and EUK 1124462 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Mycosocceria (gen. nov.) and other potentially genus-level groups represented by sequences EUK 1102426 (forest soil in Puerto Rico), EUK 0531595 (orchard soil in Estonia), and EUK 1202279 (forest soil in Italy).</p></div>	https://treatment.plazi.org/id/0082E1A2F1215F05BEC5A7528320CB27	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
80E2C6E722AC5D498845C73A33A25A0E.text	80E2C6E722AC5D498845C73A33A25A0E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Mycosocceriales Tedersoo, Bahram & Esmaeilzadeh-Salestani 2025	<div><p>Mycosocceriales Tedersoo, Bahram &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Mycosocceriaceae Tedersoo, Bahram &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other species of Mortierellomycota based on diagnostic nucleotide signature in SSU V 9 (positions 1654–1663 in S. cerevisiae gattgaacgg; no mismatch allowed) and from all fungi in LSU D 2 (positions 573– 92 in the type species and 521–540 in S. cerevisiae aagttggaggaatgtggctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Mortierellomycetes, covering sequences EUK 0531595, EUK 1102426, EUK 1202279, EUK 0531631, EUK 1008618, and EUK 1124462 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 61 in EUKARYOME v 1.9. Currently includes Mycosocceriaceae (fam. nov.). Comprises potentially 20–30 species. Detected in soil (93.2 % out of the 74 records) and sediments (6.8 %) in cold temperate to hot tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/80E2C6E722AC5D498845C73A33A25A0E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
BD51D3A42BE2537A82E078190BC23410.text	BD51D3A42BE2537A82E078190BC23410.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nematovomyces soinasteensis Tedersoo	<div><p>Nematovomyces soinasteënsis Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Nematovomyces based on ITS 2 (positions 491–510 aaaaccctttttcccccaca; one mismatch allowed) and LSU (positions 601–620 tgttcttggtactgagttta; one mismatch allowed) as indicated in Fig. 56. Intraspecific variation up to 2.8 % in ITS 2 and up to 0.3 % in LSU. Interspecific distance at least 8.0 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 000860 (holotype); eDNA sequence EUK 1124397 = OZ 253814 (legitype); eDNA sample TUE 100860 (nucleotype); GSMc plot S 328, Betula pendula dominated forest in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.7678&amp;materialsCitation.latitude=58.3322" title="Search Plazi for locations around (long 26.7678/lat 58.3322)">Soinaste</a>, Estonia, 58.3322°N, 26.7678°E .</p><p>Description.</p><p>Other sequences: EUK 1200775 (GSMc plot S 1183, mixed forest soil in Aldino, Italy, 46.4072°N, 11.4964°E); EUK 1217250 (GSMc plot G 4679, Salix triandra swamp soil in Prangli Rivimaa, Estonia, 59.6151°N, 24.9871°E); EUK 0330847 (GSMc plot S 141, Carpinus- Quercus - Alnus forest soil in Shirgah, Iran, 36.2122°N, 52.8243°E); EUK 0483680 (GSMc plot G 4196, mixed forest soil in Kahvena, Estonia, 58.2799°N, 25.2316°E); EUK 1217249 (GSMc plot G 4800, Ulmus-Alnus temperate forest soil in Tuhkja, Estonia, 58.4159°N, 25.2327°E); EUK 033840 (GSMc plot S 939, tropical rainforest soil in Parotania, Bolivia, – 17.5815, – 66.3443°E); and EUK 0330843 (GSMc plot G 4030, Quercus-Arbutus forest soil in Ain Boumahdi, Morocco, 34.0096, – 4.2858, 24.9871°E).</p><p>Etymology.</p><p>Soinaste (Estonian) refers to the type locality.</p><p>Notes.</p><p>Found in forest soils in Eurasia, North Africa, Central Asia, and South America (n = 18 records). The 16 additional GlobalFungi records indicate occurrence in soil and root samples across various ecosystems and biomes in Spain, China, and the USA.</p></div>	https://treatment.plazi.org/id/BD51D3A42BE2537A82E078190BC23410	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
ED79EBD649275F33A6260BE13B115E36.text	ED79EBD649275F33A6260BE13B115E36.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nematovomyces Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Nematovomyces Tedersoo &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Nematovomyces vermicola (G. L. Barron &amp; Szuarto) Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Separated from the vascular plant-associated species and algae-associated species of Olpidium s. stricto based on reticulate to spiky ornamentation in resting spores instead of star-like shapes. Nematovomyces spp. infect nematodes, rotifers, and their eggs. Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 729–743 aaccgggtgtggcct in S. cerevisiae; no mismatch allowed) and ITS 2 (positions 68–77 aacaatgtct in N. soinasteënsis; one mismatch allowed) and LSU D 2 (positions 679–698 in N. soinasteënsis and 595–614 in S. cerevisiae: gttgtctttgttattttcca; one mismatch allowed). Forms a monophyletic, least inclusive clade in Nematovomycetaceae, covering sequences OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1107129, EUK 1102228, EUK 1204135, EUK 1124398, EUK 1124395, EUK 1124396, and EUK 1124397 (Figs 1, 55).</p><p>Description.</p><p>Sporangia in the host cell singly or in rows, spherical or pyriform, 15–35 µm diam., with a smooth wall and curved exit tube. Zoospores spherical, 2.5–3.5 µm diam, with one posterior flagellum. Flagellum arched near the insertion point to the zoospore body. Thallus produces a single evacuation tube that leaves a narrow exit tube. Resting spores spherical or oblong, with surface ornamented by delicate reticular pattern or linear or branched spines, arranged in chains outside the animal cuticle or in culture. Infects nematodes, rotifers, and their eggs internally.</p><p>Notes.</p><p>Includes species parasitizing on nematodes, rotifers, and their eggs. Comprises about 50 potential species represented by sequences OQ 702947 (peatland rotifer in MI, USA), GQ 330624 (peatland water in Switzerland), OQ 702883 (rotifer egg in lake water in ONT, Canada), JN 054659 (activated sludge in NSW, Australia), JN 054675 (activated sludge in Canada), EUK 1100016 (permafrost in Canada), EUK 1107129 (lake water in Sweden), EUK 1102228 (forest soil in Puerto Rico), EUK 1204135 (lake sediment in Lithuania), EUK 1124398 (forest soil in Estonia), EUK 1124395 (grassland soil in Estonia), and EUK 1200775 (forest soil in Italy).</p></div>	https://treatment.plazi.org/id/ED79EBD649275F33A6260BE13B115E36	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
989CDAF51A785DB9B37CC5543904D488.text	989CDAF51A785DB9B37CC5543904D488.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nematovomyces vermicola (G. L. Barron & Szuarto) Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Nematovomyces vermicola (G. L. Barron &amp; Szuarto) Tedersoo &amp; Esmaeilzadeh-Salestani comb. nov.</p><p>Basionym.</p><p>Olpidium vermicola G. L. Barron &amp; Szuarto, Mycologia 78 (6): 972 (1986) [128304].</p><p>Diagnosis.</p><p>Separated from other species of Nematovomyces by echinulate resting spores and parasitism exclusively on nematode eggs.</p><p>Type.</p><p>Microscope slide OAC 10841 (holotype), rotting wood at Lake Manitowabing, Ontario, Canada, 45.5, – 79.9; eDNA sequence OQ 702805 (legitype) from the type locality .</p><p>Description.</p><p>As in Barron and Szuarto (1986).</p><p>Etymology.</p><p>Nematoda and ovum (Latin) refer to roundworms and their eggs, respectively, and describe the specific association with nematode eggs, indicating parasitic relationship with these structures.</p><p>Notes.</p><p>There are no ITS sequences or other eDNA sequences matching N. vermicola .</p></div>	https://treatment.plazi.org/id/989CDAF51A785DB9B37CC5543904D488	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3AC66B436BE454D7849B0E398F1BAB74.text	3AC66B436BE454D7849B0E398F1BAB74.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nematovomycetaceae Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Nematovomycetaceae Tedersoo &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Nematovomyces Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 68–77 aacaatgtct or atcaatggtt in N. soinasteënsis; one mismatch allowed). Forms a monophyletic, least inclusive clade in Nematovomycetales, covering sequences AB 971072, EUK 1106088, OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1107129, EUK 1102228, EUK 1204135, EUK 1124398, EUK 1124395, EUK 1124396, and EUK 1124397 (Fig. 1).</p><p>Notes.</p><p>Includes Nematovomyces (gen. nov.) and another potentially genus-level group represented by sequences AB 971072 (lake water in Japan) and EUK 1106088 (peatland soil in Sweden).</p></div>	https://treatment.plazi.org/id/3AC66B436BE454D7849B0E398F1BAB74	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
986895C5F6DA59F7B958013848DF120C.text	986895C5F6DA59F7B958013848DF120C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nematovomycetales Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Nematovomycetales Tedersoo &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Nematovomycetaceae Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 127–146 in N. soinasteënsis and S. cerevisiae atccggyaggtatacctatt or gcctgcaggtatacctattt or acgtgcaagtatacctattt; one mismatch allowed) and in LSU D 3 (positions 905–919 in N. soinasteënsis and 748–762 in S. cerevisiae: acccgatcctagctc; two mismatches allowed). Forms a monophyletic, least inclusive clade in Nematovomycetes, covering sequences EUK 1137920, EUK 1124402, EUK 1124400, AB 971072, EUK 1106088, OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1107129, EUK 1102228, EUK 1204135, EUK 1124398, EUK 1124395, EUK 1124396, EUK 1200775, and EUK 1124397 (Fig. 1).</p><p>Notes.</p><p>Currently includes Nematovomycetaceae and another potentially family-level group represented by sequences EUK 1137920 (forest soil in Estonia), EUK 1202819 (grassland soil in Estonia), EUK 1113339 (lake water in Sweden), and EUK 1124400 (lake sediment in Estonia).</p></div>	https://treatment.plazi.org/id/986895C5F6DA59F7B958013848DF120C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3E348D7CA3D057D6B52935DB51798B69.text	3E348D7CA3D057D6B52935DB51798B69.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nematovomycetes Tedersoo & Esmaeilzadeh-Salestani	<div><p>Nematovomycetes Tedersoo &amp; Esmaeilzadeh-Salestani class. nov.</p><p>Type order.</p><p>Nematovomycetales Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 127–146 in N. soinasteënsis and S. cerevisiae: atccggyaggtatacctatt or gcctgcaggtatacctattt or acgtgcaagtatacctattt or atccaaagagtatacttgtt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Nematovomycota, covering sequences EUK 1217270, EUK 1137920, EUK 1124402, EUK 1124400, AB 971072, EUK 1106088, OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1107129, EUK 1102228, EUK 1204135, EUK 1124398, EUK 1124395, EUK 1124396, EUK 1200775, and EUK 1124397 (Fig. 1).</p><p>Notes.</p><p>Nematovomycetes currently harbors Nematovomycetales (ord. nov.) and a potentially order-level group represented by the sequence EUK 1217270 (lake sediment in Portugal).</p></div>	https://treatment.plazi.org/id/3E348D7CA3D057D6B52935DB51798B69	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
31C68CB955F65C2F86CEAC8A33D3AA3D.text	31C68CB955F65C2F86CEAC8A33D3AA3D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nematovomycota Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Nematovomycota Tedersoo &amp; Esmaeilzadeh-Salestani phyl. nov.</p><p>Type class.</p><p>Nematovomycetes Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in the LSU 5´end (positions 5–14 in the type species and S. cerevisiae cctgaawtta; one mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 1124405, EUK 1137897, EUK 1138000, EUK 1105583, EUK 1217236, EU 162639, AB 971078, OL 869110, EUK 1217234, EUK 1137920, EUK 1124400, AB 971072, EUK 1106088, OQ 702947, GQ 330624, OQ 702883, JN 054659, JN 054675, OQ 702805, EUK 1100016, EUK 1217270, and EUK 1124397 (Fig. 1).</p><p>Notes.</p><p>Encoded as clade GS 46 in EUKARYOME v 1.9. Currently harbors Nematovomycetes (class. nov.) and potentially class-level groups represented by sequences EUK 1124405 (soil in Estonia), EUK 1137897 (lake sediment in Germany), EUK 1138000 (lake sediment in Germany), EUK 1105583 (marine water near Sweden), EUK 1217236 (lake sediment in Serbia), EU 162639 (lake water in France), AB 971078 (lake water in Japan), OL 869110 (lake water in Germany), and EUK 1217234 (brackish water sediment in Estonia). Nematovomycota comprises potentially 240–260 species. Detected in soil (49.3 % out of 458 records), sediments (26.4 %), and water (23.6 %). Seto et al. (2023) revealed connections to nematode eggs (OQ 702805), rotifer eggs (OQ 702883), or rotifers (OQ 702947), suggesting parasitism on microfauna in contrasting environments. Recorded from high arctic to wet tropical biomes across all continents, including Antarctica.</p></div>	https://treatment.plazi.org/id/31C68CB955F65C2F86CEAC8A33D3AA3D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
0EFCBE20C5D45127852B555747970FA4.text	0EFCBE20C5D45127852B555747970FA4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Neocallimastigomycota M. J. Powell	<div><p>Neocallimastigomycota M. J. Powell, Mycological Research 111 (5): 516 (2007)</p><p>Type class.</p><p>Neocallimastigomycetes M. J. Powell .</p><p>Description.</p><p>As in Hibbett et al. (2007).</p><p>Notes.</p><p>Currently harbors Neocallimastigomycetes, Aquamastigomycetes (class. nov.), Cantoromastigomycetes (class. nov.), Dobrisimastigomycetes (class. nov.), Palomastigomycetes (class. nov.), Sedimentomastigomycetes (class. nov.), and potentially class-level taxa represented by sequences EUK 1173013 (forest soil in Puerto Rico), EUK 0534646 (tundra soil in Buryatiya), EUK 1191158 (forest soil in Altai Kray, Russian Federation), EUK 0534648 (forest soil in Mexico), EUK 1200010 (grassland soil in Italy), and EUK 0534645 (forest soil in South Africa).</p></div>	https://treatment.plazi.org/id/0EFCBE20C5D45127852B555747970FA4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
BF2354CFBCC25551B4657944C8CE358D.text	BF2354CFBCC25551B4657944C8CE358D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Olpidiomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Olpidiomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 150 (2018)</p><p>Type phylum.</p><p>Olpidiomycota Doweld .</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Currently harbors Olpidiomycota .</p></div>	https://treatment.plazi.org/id/BF2354CFBCC25551B4657944C8CE358D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
F3574A173B0A5E59AC01304343BE78C7.text	F3574A173B0A5E59AC01304343BE78C7.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Olpidiomycota Doweld	<div><p>Olpidiomycota Doweld, Index Fungorum 42: 1 (2013)</p><p>Type class.</p><p>Olpidiomycetes Doweld .</p><p>Description.</p><p>As in Doweld (2013).</p><p>Notes.</p><p>Currently harbors Olpidiomycetes, Bryolpidiomycetes (class. nov.), Chthonolpidiomycetes (class. nov.), and Savannolpidiomycetes (class. nov.).</p></div>	https://treatment.plazi.org/id/F3574A173B0A5E59AC01304343BE78C7	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
07FBEC084A265224B840BD08BB850074.text	07FBEC084A265224B840BD08BB850074.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Palomastigaceae Tedersoo 2025	<div><p>Palomastigaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Palomastix Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1664–1678 in S. cerevisiae tttagtgaggactcg; no mismatch allowed) and 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag or gcttcatggtattccgtga; one mismatch allowed). Forms a monophyletic, least inclusive clade in Palomastigales, covering sequences EUK 1124846, EUK 1123686, EUK 0320705, and EUK 0320700 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Harbors Palomastix (gen. nov.) and potential genus-level taxa represented by sequences EUK 0574070 (marine sediment in the Philippines), EUK 0137263 (forest soil in Mexico), and EUK 1124846 (wasteland soil in Estonia).</p></div>	https://treatment.plazi.org/id/07FBEC084A265224B840BD08BB850074	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
8E313381A6E258B994F917D790EFCD1F.text	8E313381A6E258B994F917D790EFCD1F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Palomastigales Tedersoo 2025	<div><p>Palomastigales Tedersoo ord. nov.</p><p>Type family.</p><p>Palomastigaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1664–1678 in S. cerevisiae tttagtgaggactcg; no mismatch allowed) and 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag or gcttcatggtattccgtga; one mismatch allowed). Forms a monophyletic, least inclusive clade in Palomastigomycetes, covering sequences EUK 1124846, EUK 1123686, EUK 0320705, and EUK 0320700 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Palomastigaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/8E313381A6E258B994F917D790EFCD1F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
BF5B17104026529F9F06727027061BDD.text	BF5B17104026529F9F06727027061BDD.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Palomastigomycetes Tedersoo	<div><p>Palomastigomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Palomastigales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 8 (positions 1664–1678 in S. cerevisiae tttagtgaggactcg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Neocallimastigomycota, covering sequences EUK 1124846, EUK 1123686, EUK 0320705, and EUK 0320700 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 38 Y in EUKARYOME v 1.9. Currently harbors Palomastigales (ord. nov.). Comprises potentially seven species. Detected in sediment (89.5 % out of 19 records) and soil (10.5 %) samples in boreal to tropical biomes in Eurasia and North America. Relative commonness in sediments suggests that members of this class are facultative anaerobes.</p></div>	https://treatment.plazi.org/id/BF5B17104026529F9F06727027061BDD	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
7151F516666954FCA9E5A571EF62631F.text	7151F516666954FCA9E5A571EF62631F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Palomastix lacustris Tedersoo 2025	<div><p>Palomastix lacustris Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Palomastix based on ITS 2 (positions 225–244 ctaaaagtcgggtttgattt; one mismatch allowed) and ITS 1 (positions 464–483 cagcaggtcttgactgactt; one mismatch allowed) as indicated in Fig. 24. Intraspecific variation up to 1.4 % in ITS 2. Interspecific distance at least 9.2 % in ITS 2.</p><p>Type.</p><p>Vouchered sediment sample TUE 030088 (holotype); eDNA sequence EUK 1123686 = OZ 253797 (legitype); eDNA sample TUE 130088 (nucleotype); FunAqua lake sediment sample W 0021 s; <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.9143&amp;materialsCitation.latitude=58.083" title="Search Plazi for locations around (long 26.9143/lat 58.083)">Palojärv</a>, Estonia, 58.0830°N, 26.9143°E .</p><p>Description.</p><p>Other sequences: EUK 0320710 and EUK 0574068 (type locality); EUK 0320711, EUK 0320713 (FunAqua lake sediment sample in Viitna Pikkjärv, Estonia, 59.4469°N, 26.0107°E); and EUK 0320712 (FunAqua lake sediment sample W 0992 s in Svartkulpen, Norway, 59.9741°N, 10.7373°E).</p><p>Etymology.</p><p>&gt; Palo (Estonian) refers to the type locality, Lake Palojärv; lacustris refers to habitat in lakes.</p><p>Notes.</p><p>Found in sediment samples in Northern Europe (n = 3). There are no records in GlobalFungi.</p></div>	https://treatment.plazi.org/id/7151F516666954FCA9E5A571EF62631F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
880F0DA574395ACD9D697205386B0EC4.text	880F0DA574395ACD9D697205386B0EC4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Palomastix Tedersoo 2025	<div><p>Palomastix Tedersoo gen. nov.</p><p>Type species.</p><p>Palomastix lacustris Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in 5.8S (positions 116–135 in type species and S. cerevisiae gcctcccggtattccaggag; one mismatch allowed), SSU V 9 (positions 1691–1710 in S. cerevisiae tgttgggctcacgccctcct; one mismatch allowed), and ITS 2 (positions 129–148 in type species tctcaagttaagtgattggt; two mismatches allowed). Forms a monophyletic, least inclusive clade in Palomastigaceae, covering sequences EUK 1123686, EUK 0320705, and EUK 0320700 (Figs 1, 23).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises four potential species represented by sequences EUK 0320699 (river sediment in Portugal), EUK 0320700 (lake sediment in Estonia), EUK 0320701 (lake sediment in Lithuania), EUK 0320702 (lake sediment in Spain), and EUK 0320705 (lake sediment in Norway).</p></div>	https://treatment.plazi.org/id/880F0DA574395ACD9D697205386B0EC4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3D7B89BF1BA55054AC0D06CEF12A5232.text	3D7B89BF1BA55054AC0D06CEF12A5232.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pantelleria saittana Tedersoo 2025	<div><p>Pantelleria saittana Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Pantelleria based on ITS 2 (positions 131–155 tttacatctttttctaaacttaatc; one mismatch allowed) and LSU D 2 (positions 722–741 aagagtgatggtgatcaagt; one mismatch allowed) as indicated in Fig. 3. Intraspecific variation up to 3.8 % in ITS 2 and up to 1.5 % in LSU. Interspecific distance at least 10.1 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 000518 (holotype); eDNA sequence EUK 1200019 = OZ 253786 (legitype); eDNA sample TUE 100518 (nucleotype); GSMc plot G 3487, Quercus ilex forest soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=12.0149&amp;materialsCitation.latitude=36.8185" title="Search Plazi for locations around (long 12.0149/lat 36.8185)">Ponta Spadillo</a>, Pantelleria, Italy, 36.8185°N, 12.0149°E .</p><p>Description.</p><p>Other sequences: OW 839340 and OW 840352 (unspecified soil in Tianshan Mountains, Uyghur Autonomous Region, China); EUK 1138064 (GSMc plot G 4627, mixed forest soil in Tudusoo, Estonia, 59.11368°N, 26.75944°E); EUK 1120811 (GSMc plot S 281, Quercus robur alley soil in Tartu, Estonia, 58.379°N, 26.706°E); EUK 0348125 (urban park soil in Niort, France, 46.325, – 0.4672°E); MH 625427 (microcosm soil in New Zealand); and MF 484888 (unspecified soil in Great Britain).</p><p>Etymology.</p><p>&gt; Pantelleria (Maltese) refers to the type locality, and Saitta (Sicilian) refers to Alessandro Saitta, who collected material from the type locality.</p><p>Notes.</p><p>Found in soil samples and occasionally in oceanic sediments in temperate and subtropical regions worldwide (n = 18 records). The 86 GlobalFungi records confirm global soil distribution.</p></div>	https://treatment.plazi.org/id/3D7B89BF1BA55054AC0D06CEF12A5232	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
0C93F2C096145E579A4C29093B795F7D.text	0C93F2C096145E579A4C29093B795F7D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pantelleria Tedersoo 2025	<div><p>Pantelleria Tedersoo gen. nov.</p><p>Type species.</p><p>Pantelleria saittana Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in SSU V 9 (positions 1671–1684 gaamctcggatcgtt in S. cerevisiae; one mismatch allowed), ITS 2 (positions 99–113 tcatttacttttaag in type species; one mismatch allowed), and 5.8S (positions 119–133 in type species and 120–134 in S. cerevisiae ataggtattcctrtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Pantelleriaceae, covering sequences EUK 1200019 and EUK 1137930 (Figs 1, 2).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Contains 6–7 potential species represented by sequences MW 163794 (cropland soil in Italy), OU 496195 (unspecified soil in China), EUK 0348072 (cropland soil in Benin), EUK 0348070 ( woodland soil in Turkey), EUK 1137930 (urban soil in Estonia), and EUK 0516893 (park soil in Estonia).</p></div>	https://treatment.plazi.org/id/0C93F2C096145E579A4C29093B795F7D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
E1A8C972094256BFAF1B0DCA2BFA8931.text	E1A8C972094256BFAF1B0DCA2BFA8931.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pantelleriaceae Tedersoo 2025	<div><p>Pantelleriaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Pantelleria Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in SSU V 9 (positions 1671–1684 in S. cerevisiae gaamctcggatcgtt; one mismatch allowed), and 5.8S (positions 119–133 in type species and 120–134 in S. cerevisiae ataggtattcctrtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Pantelleriales, covering sequences EUK 1200019 and EUK 1137930 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Pantelleria (gen. nov.).</p></div>	https://treatment.plazi.org/id/E1A8C972094256BFAF1B0DCA2BFA8931	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
5920EF54D087557FBA2E65AA00F2FDEA.text	5920EF54D087557FBA2E65AA00F2FDEA.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pantelleriales Tedersoo 2025	<div><p>Pantelleriales Tedersoo ord. nov.</p><p>Type family.</p><p>Pantelleriaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in SSU V 7 (positions 1389–1408 in S. cerevisiae ctatcgacgtwtagtcgatg; no mismatch allowed). Forms a monophyletic, least inclusive clade in Pantelleriomycetes, covering sequences EUK 1200019, EUK 1137930, EUK 1120813, and EUK 1700280 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Pantelleriaceae (fam. nov.) and potential family-level groups represented by sequences EUK 1700280 (forest soil in MI, USA), EUK 1217356 (lake sediment in Brazil), EUK 1138063 (moss sample in Estonia), EUK 1138061 (wasteland soil in Estonia), EUK 0348101 (forest soil in the Canary Islands), EUK 0348102 (desert soil in Oman), EUK 0348062 (desert soil in Qatar), EUK 0348068 (grassland soil in Bangladesh), EUK 0348055 ( woodland soil in Ghana), EUK 0348090 (shrubland soil in Argentina), and EUK 1120813 (lake sediment in Ethiopia).</p></div>	https://treatment.plazi.org/id/5920EF54D087557FBA2E65AA00F2FDEA	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
199821CC2B6558E3A970E6760E830C88.text	199821CC2B6558E3A970E6760E830C88.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Pantelleriomycetes Tedersoo	<div><p>Pantelleriomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Pantelleriales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other Aphelidiomycota based on diagnostic nucleotide signature in LSU 5 ’ end (positions 42–51 in type species and S. cerevisiae tatcattaag; no mismatch allowed). Forms a monophyletic, least inclusive clade in Aphelidiomycota, covering sequences EUK 1203048, EUK 1205018, EUK 1200019, EUK 1137930, EUK 1120815, EUK 1103262, GU 568135, EUK 1200059, EUK 1138870, EUK 1138872, EUK 1120814, EUK 1102231, and EUK 1201826 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 55 in EUKARYOME v 1.9. Currently harbors Pantelleriales (ord. nov.) and potentially order-level groups represented by sequences EUK 1203048 (forest soil in Italy), EUK 1205018 (forest soil in Italy), GU 568135 (experimental soil in China), EUK 1200059 (forest soil in Estonia), EUK 1102231 (lake water in Sweden), EUK 1120815 (cropland soil in Estonia), EUK 1201826 (forest soil in Italy), EUK 1138870 (forest soil in New Zealand), EUK 1138872 (forest soil in New Zealand), EUK 1120814 (urban soil in Estonia), EUK 1671420 (forest soil in NA, USA), EUK 1103262 (lake sediment in Sweden), and EUK 1700281 (desert soil in Oman). Comprises potentially 170–200 species. Detected in soil (98.9 % out of 633 records), freshwater (0.5 %), sediments (0.3 %), and plant leaves (0.3 %) in high arctic to wet tropical biomes across all continents, including Antarctica.</p></div>	https://treatment.plazi.org/id/199821CC2B6558E3A970E6760E830C88	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
710F5E4C87B45F4297A651672DF63862.text	710F5E4C87B45F4297A651672DF63862.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parakickxella borikenica Tedersoo 2025	<div><p>Parakickxella borikenica Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Parakickxella based on ITS 2 (positions 98–117 cgtgaacatatggtgccccc; one mismatch allowed) and LSU D 2 (positions 444–463 in the type species and 436–455 in S. cerevisiae cgccgcgctgtttgtgcgcg; one mismatch allowed) as indicated in Fig. 48. Intraspecific difference up to 1.4 % in ITS 2 and up to 0.5 % in LSU. Interspecific distance at least 15.0 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 000315 (holotype); eDNA sequence EUK 1189321 = OZ 253810 (legitype); eDNA sample TUE 100315 (nucleotype); GSMc plot S 045, tropical rainforest soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-65.8167&amp;materialsCitation.latitude=18.3167" title="Search Plazi for locations around (long -65.8167/lat 18.3167)">El Yunque</a>, Puerto Rico, 18.3167, –65.8167 °E .</p><p>Description.</p><p>Other sequences: EUK 1107422 (tropical rainforest soil in El Yunque, Puerto Rico, 18.29, – 65.78); EUK 0147219 (GSMc plot G 5034, tropical rainforest soil in Los Pinos, Puerto Rico, 18.1268, – 66.0724°E); and GlobalFungi accession dfbf 3 c 41964 a 835260 bb 3 a 9 afcdaf 69 a (tropical rainforest soil in Luquillo, Puerto Rico, 18.3, – 65.8).</p><p>Etymology.</p><p>Parakickxella (Latin) refers to a taxon distant from Kickxella, and Boriken (Taino) refers to the native name of Puerto Rico, where the type material and other specimens originate.</p><p>Notes.</p><p>Found exclusively in soil in Puerto Rico, which is confirmed by an additional GlobalFungi record.</p></div>	https://treatment.plazi.org/id/710F5E4C87B45F4297A651672DF63862	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
F3551AD13938564285D33636089EAA44.text	F3551AD13938564285D33636089EAA44.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parakickxella Tedersoo 2025	<div><p>Parakickxella Tedersoo gen. nov.</p><p>Type species.</p><p>Parakickxella borikenica Tedersoo .</p><p>Diagnosis.</p><p>Separation from other fungi based on diagnostic nucleotide signatures in SSU V 3 (positions 677–691 in S. cerevisiae gttccgcccggtctc; one mismatch allowed) and LSU D 2 (positions 697–711 in the type species and 687–701 in S. cerevisiae cgacacgtcatggtg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Parakickxellaceae, covering sequences EUK 1189325, EUK 1189316, and EUK 1189321 (Figs 1, 47).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially about 150–170 species represented by sequences EUK 1189325 (forest soil in Puerto Rico), EUK 1189316 (forest soil in Dominica), EUK 1189312 (forest soil in Dominica), EUK 0483976 (forest soil in Guadeloupe), EUK 1189319 (forest soil in Guadeloupe), EUK 0530705 (forest soil in Costa Rica), EUK 1189316 (forest soil in Dominica), and EUK 1189306 (forest soil in Puerto Rico).</p></div>	https://treatment.plazi.org/id/F3551AD13938564285D33636089EAA44	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
4729255D8B905E8AA5F35D7EFD865685.text	4729255D8B905E8AA5F35D7EFD865685.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parakickxellaceae Tedersoo 2025	<div><p>Parakickxellaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Parakickxella Tedersoo .</p><p>Diagnosis.</p><p>Separation from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 117–126 in the type species and 120–129 in S. cerevisiae tggattactc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Parakickxellales, covering sequences EUK 1700155, EUK 1189325, EUK 1189316, and EUK 1189321 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Parakickxella (gen. nov.) and another potentially genus-level group represented by the sequence EUK 1700155 (forest soil in Georgia).</p></div>	https://treatment.plazi.org/id/4729255D8B905E8AA5F35D7EFD865685	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
E71D5B4E964C5D1E9D0A2B8934C66393.text	E71D5B4E964C5D1E9D0A2B8934C66393.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parakickxellales Tedersoo 2025	<div><p>Parakickxellales Tedersoo ord. nov.</p><p>Type family.</p><p>Parakickxellaceae Tedersoo .</p><p>Diagnosis.</p><p>Separation from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1476–1495 in S. cerevisiae ccaagkcaacgagtytacaa; one mismatch allowed) and LSU D 1 (positions 184–198 in type species and 180–194 in S. cerevisiae ggtataatttgcctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Parakickxellomycetes, covering sequences EUK 1189320, EUK 1189314, EUK 1100806, EUK 1189309, UDB 014747, EUK 1107625, EUK 1105293, EUK 1189310, EUK 1700155, EUK 1189325, EUK 1189316, and EUK 1189321 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Parakickxellaceae (fam. nov.) and other potential family-level groups represented by sequences EUK 1189320 (forest soil in Puerto Rico), EUK 1189314 (forest soil in Dominica), EUK 1100806 (agricultural soil in Great Britain), EUK 1189309 (forest soil in Dominica), UDB 014747 ( woodland soil in Madagascar), EUK 1107625 (unspecified soil in Tibet), EUK 1105293 (forest soil in Puerto Rico), and EUK 1189310 (forest soil in Dominica).</p></div>	https://treatment.plazi.org/id/E71D5B4E964C5D1E9D0A2B8934C66393	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
CBF6F269FC8856AE908EFC1807888A25.text	CBF6F269FC8856AE908EFC1807888A25.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Parakickxellomycetes Tedersoo 2025	<div><p>Parakickxellomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Parakickxellales Tedersoo .</p><p>Diagnosis.</p><p>Separation from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1476–1495 in S. cerevisiae ccaagkcaacgagtytacaa; two mismatches allowed) and LSU D 1 (positions 184–198 in type species and 180–194 in S. cerevisiae ggtataatttgcctg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Kickxellomycota, covering sequences EUK 1189320, EUK 1189314, EUK 1100806, EUK 1189309, UDB 014747, EUK 1107625, EUK 1105293, EUK 1189310, EUK 1700155, EUK 1189325, EUK 1189316, and EUK 1189321 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 19 in EUKARYOME v 1.9. Currently harbors Parakickxellales. Comprises potentially 1150–1250 species. Detected in soil (98.6 % out of 1597 records), sediments (1.2 %), and water (0.2 %). Found in arctic tundra to tropical biomes across all continents except Antarctica, but present on Subantarctic islands. Relatively more common and diverse in the neotropics (37.3 % of records).</p></div>	https://treatment.plazi.org/id/CBF6F269FC8856AE908EFC1807888A25	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
29EC75DDEBF85828A95E588A79B3F4CD.text	29EC75DDEBF85828A95E588A79B3F4CD.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Paraspizellomyces parrentiae Tedersoo 2025	<div><p>Paraspizellomyces parrentiae Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Paraspizellomyces based on ITS 2 (positions 220–239 tttatgaattartgattgta; no mismatch allowed) and LSU (positions 562–581 ccgagtgttatagcctgagg; no mismatch allowed) as indicated in Fig. 5. Intraspecific variation up to 3.7 % in ITS 2. Interspecific distance at least 3.7 % in ITS 2; i. e., there is no clear barcode gap in ITS 2. In ITS 1, the maximum intraspecific difference 2.4 %, and the minimum interspecific distance 3.3 %.</p><p>Type.</p><p>Vouchered soil sample TUE 002024 (holotype); eDNA sequence EUK 1187441 = OZ 253787 (legitype); eDNA sample TUE 102024 (nucleotype) GSMc plot G 5047, tropical rainforest forest soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-61.745&amp;materialsCitation.latitude=16.1856" title="Search Plazi for locations around (long -61.745/lat 16.1856)">Morne Louis</a>, Guadeloupe, 16.1856, –61.7450 .</p><p>Description.</p><p>Other sequences: EF 619657 (soil in Pinus taeda plantation, NC, USA); EUK 0327288 (GSMc plot G 6004, tropical rainforest soil in Cascada Julieta in Panama, 9.2274, –79.4312); EUK 0327292 (GSMc plot G 4982, subtropical rainforest soil in Weiloi, Meghalaya, India, 25.3570°N, 91.6060°E); EUK 0327297 (GSMc plot S 372, subtropical forest soil in Menglun, Yunnan, China, 21.572°N, 101.57°E); EUK 0327298 (GSMc plot S 013, tropical woodland soil in Isalo, Madagascar, –22.5339, 45.3703); EUK 0327299 (GSMc plot S 765, tropical rainforest soil in Mbomole, Tanzania, –5.0946, 38.6292); and EUK 0519411 (GSMc plot S 1190, tropical rainforest soil in La Palma, Costa Rica, 10.5046, –84.6949).</p><p>Etymology.</p><p>Para (Greek) and Spizellomyces (Latin) refer to phylogenetic relatedness to Spizellomycetales, and Parrent (English) refers to Jeri Lynn Parrent, who was the first to collect material from this species (EF 619657; Parrent and Vilgalys 2007).</p><p>Notes.</p><p>Found in 18 soil samples in tropical and warm temperate forest habitats in North and South America, Africa, and Asia. The 33 additional GlobalFungi records confirm these findings but add that plant tissues may be an additional habitat (12.1 % of records).</p></div>	https://treatment.plazi.org/id/29EC75DDEBF85828A95E588A79B3F4CD	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
75DAB7E4C1B75619BFF38377DCF725F0.text	75DAB7E4C1B75619BFF38377DCF725F0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Paraspizellomyces Tedersoo 2025	<div><p>Paraspizellomyces Tedersoo gen. nov.</p><p>Type species.</p><p>Paraspizellomyces parrentiae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 1 (positions 228–237 in type species and 227–236 in S. cerevisiae taacgaccca; one mismatch allowed) and SSU V 9 (positions 1695–1709 in S. cerevisiae aatttcggttgctgg or agtttcggccgctgg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Paraspizellomycetaceae, covering sequences EUK 1187441, EUK 1187447, UDB 014658, and EUK 1100628 (Figs 1, 4).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially 20–30 species represented by sequences EUK 1187447 (forest soil in Puerto Rico), UDB 014658 (forest soil in Madagascar), EUK 1100628 (forest soil in Puerto Rico), and GQ 921827 (forest soil in Australia).</p></div>	https://treatment.plazi.org/id/75DAB7E4C1B75619BFF38377DCF725F0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2C2903E2456552488C52A534C8F54406.text	2C2903E2456552488C52A534C8F54406.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Paraspizellomycetaceae Tedersoo 2025	<div><p>Paraspizellomycetaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Paraspizellomyces Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 2 (positions 578–592 in type species and 562–576 in S. cerevisiae aaggtcatgcttt; one mismatch allowed) and ITS 2 (positions 134–148 in type species aatggttcccaagtg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Paraspizellomycetales, covering sequences EUK 1187441, EUK 1187447, UDB 014658, EUK 1100628, EUK 1123745, and EUK 1139262 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Paraspizellomyces (gen. nov.) and another potentially genus-level group represented by sequences EUK 1123745 (forest soil in Estonia), and EUK 1139262 (forest soil in New Zealand).</p></div>	https://treatment.plazi.org/id/2C2903E2456552488C52A534C8F54406	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
A5C16A3D11ED577CA5825644C11E5AAD.text	A5C16A3D11ED577CA5825644C11E5AAD.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Paraspizellomycetales Tedersoo 2025	<div><p>Paraspizellomycetales Tedersoo ord. nov.</p><p>Type family.</p><p>Paraspizellomycetaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 1 (positions 128–142 in type species and 123–137 in S. cerevisiae cggttcgccggtgcg or gggttcttacctatg or gggttccacctatgc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Spizellomycetes, covering sequences EUK 1138322, EUK 1152022, EUK 1187448, EUK 1202178, EUK 1187441, EUK 1187447, UDB 014658, EUK 1100628, EUK 1123745, and EUK 1139262 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 14 in EUKARYOME v 1.9. Currently includes Paraspizellomycetaceae (fam. nov.) and one or more potentially family-level groups represented by sequences EUK 1138322, EUK 1152022 (both forest soil in New Zealand), EUK 1187448 (forest soil in Chile), and EUK 1202178 (tundra soil in Norway). Comprises potentially around 50–70 species. Detected in soil (94.6 % out of the 159 records), sediments (4.2 %), and freshwater (1.2 %) in tundra to tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/A5C16A3D11ED577CA5825644C11E5AAD	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
52332B84FF125789A6A676801B58DE74.text	52332B84FF125789A6A676801B58DE74.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Rozellomyceta Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Rozellomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 147 (2018)</p><p>Type phylum.</p><p>Rozellomycota Doweld .</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Rozellomyceta currently harbors Rozellomycota .</p></div>	https://treatment.plazi.org/id/52332B84FF125789A6A676801B58DE74	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
EDEC19532BAA5A76B1C8DD6A00BFE92F.text	EDEC19532BAA5A76B1C8DD6A00BFE92F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Rozellomycota Doweld	<div><p>Rozellomycota Doweld, Index Fungorum 43: 1 (2013)</p><p>Type class.</p><p>None.</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Currently harbors Rozellomycetes, Microsporidea, Gelotisporidiomycetes (class. nov.), and Sumavosporidiomycetes (class. nov.).</p></div>	https://treatment.plazi.org/id/EDEC19532BAA5A76B1C8DD6A00BFE92F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
A73530CCE5215BD5874CFF06EA9B533E.text	A73530CCE5215BD5874CFF06EA9B533E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ruderalia cosmopolita Tedersoo 2025	<div><p>Ruderalia cosmopolita Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Ruderalia based on ITS 2 (positions 154–176 ggaggcttgaaattgagaaaaag; one mismatch allowed) and LSU D 2 (positions 583–607 cctcgggaatgtgatccgcctttac; one mismatch allowed) as indicated in Fig. 36. Intraspecific variation up to 9.8 % (including up to 7 % in the type locality) in ITS 2 due to multiple microsatellite-like repeats and long homopolymers and up to 1.5 % in LSU. Interspecific distance&gt; 20 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 028393 (holotype); eDNA sequence EUK 1138161 = OZ 253804 (legitype); eDNA sample TUE 128393 (nucleotype); GSMc plot G 5804, wasteland soil in Tartu, Estonia, 58.3816°N, 26.6916°E .</p><p>Description.</p><p>Other sequences: EUK 1137942, EUK 1137899 and EUK 1124460 (type locality); EUK 0018130 (GSMc plot S 150, Quercus woodland soil in Jamestown, CA, USA, 37.8489, –120.581); EUK 0531861 (temperate grassland soil in Murrietta, CA, USA, 33.5319, – 117.2492°E), EUK 0015594 (GSMc plot EO 077, Cistus shrubland soil in Essouira, Morocco, 31.5136, – 9.6542°E); EUK 0531686 (GSMc plot G 6066, subtropical Vachellia desert soil in Al Mudawih, Saudi Arabia, 25.8411°N, 39.2793°E); EUK 0531846 (GSMc plot G 6106, cropland soil in Betas, Iraqi Kurdistan, 37.0588°N, 42.7622°E); EUK 0531869 (GSMc plot G 5748, subtropical forest soil in Cebollati, Uruguay, – 33.8292, – 54.7672°E); and EUK 0531757 (subtropical shrubland soil in Los Panguiles, Chile, – 33.3822, – 70.9636°E).</p><p>Etymology.</p><p>Rudus (Latin) refers to a common habitat in early successional land, and cosmopolites (Greek) refers to the global distribution.</p><p>Notes.</p><p>Found exclusively in soil in multiple habitats of Europe, Asia, North America, South America, and North Africa, with most records from anthropogenic and semidry shrubland habitats (n = 25 records). The 22 additional GlobalFungi records (21 from soil) support these findings.</p></div>	https://treatment.plazi.org/id/A73530CCE5215BD5874CFF06EA9B533E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2FD5110D0131591B9339C1E8BDB57A89.text	2FD5110D0131591B9339C1E8BDB57A89.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ruderalia Tedersoo 2025	<div><p>Ruderalia Tedersoo gen. nov.</p><p>Type species.</p><p>Ruderalia cosmopolita Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 209–222 aacgatagtgaagt; two mismatches allowed). Forms a monophyletic, least inclusive clade in Ruderaliaceae, covering sequences EUK 1138161, EUK 1137899, EUK 0531800, and EUK 1124460 (Figs 1, 35).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially three species represented by sequences EUK 0531803 (cropland soil in Benin) and EUK 0531800 (forest soil in Ghana).</p></div>	https://treatment.plazi.org/id/2FD5110D0131591B9339C1E8BDB57A89	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
40AEC11BE10C559B9B015AD535B19F17.text	40AEC11BE10C559B9B015AD535B19F17.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ruderaliales Tedersoo 2025	<div><p>Ruderaliales Tedersoo ord. nov.</p><p>Type family.</p><p>Ruderaliaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 631–640 in the type species and 564–573 in S. cerevisiae acggatacgg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Ruderaliomycetes, covering sequences EUK 1138161, EUK 1137899, EUK 0531800, EUK 1124460, EUK 1103744, EUK 1103025, EUK 1103555, EUK 1103599 and EUK 1203462 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Ruderaliaceae and another potentially family-level group represented by sequences EUK 1103744, EUK 1103555, and EUK 1103599 (all forest soil in Puerto Rico) and EUK 1203462 (lake sediment in Croatia).</p></div>	https://treatment.plazi.org/id/40AEC11BE10C559B9B015AD535B19F17	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
D98BD96618B45B318C9F3AC3F9B47D2D.text	D98BD96618B45B318C9F3AC3F9B47D2D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Ruderaliomycetes Tedersoo	<div><p>Ruderaliomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Ruderaliales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 631–640 in the type species and 564–573 in S. cerevisiae acggatacgg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Mortierellomycota, covering sequences EUK 1138161, EUK 1137899, EUK 1124460, EUK 0531800, EUK 1103744, EUK 1103025, EUK 1103555, EUK 1103599, EUK 1203462, and EUK 1700231 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 49 in EUKARYOME v 1.9. Currently harbors the single order Ruderaliales (ord. nov.). Comprises potentially 40–50 species. Detected in soil (98.5 % out of the 329 records) and sediments (1.5 %) in cold temperate to hot tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/D98BD96618B45B318C9F3AC3F9B47D2D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
17B16EC9CD0F57F7BBB44B77104B0317.text	17B16EC9CD0F57F7BBB44B77104B0317.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Savannolpidiaceae Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Savannolpidiaceae Tedersoo &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Savannolpidium Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 - LSU interface (LSU positions – 2–18 in type species and S. cerevisiae aagtgatctgaaatcagaca; one mismatch allowed) and ITS 2 (positions 137–151 in type species gcgtactccttgtcc; two mismatches allowed) and SSU V 8 (positions 1589–1608 in S. cerevisiae atgattcatcagatcatgct; one mismatch allowed). Forms a monophyletic, least inclusive clade in Savannolpidiales, covering sequences EUK 1191209, EUK 1191210, EUK 0534704, EUK 1124874, EUK 1701673, EUK 1701672, and EUK 1124875 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Savannolpidiaceae includes Savannolpidium (gen. nov.) and other potential genera represented by sequences EUK 1701673 (forest soil in Madeira), EUK 1701672 ( woodland soil in Benin), EUK 0534781 (forest soil in Iraqi Kurdistan), EUK 1124875 (forest soil in Estonia), EUK 1191209 (forest soil in Puerto Rico), and EUK 0534704 (forest soil in Turkey).</p></div>	https://treatment.plazi.org/id/17B16EC9CD0F57F7BBB44B77104B0317	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
8308B450488C50FEB24AE534FED886B0.text	8308B450488C50FEB24AE534FED886B0.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Savannolpidiales Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Savannolpidiales Tedersoo &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Savannolpidiaceae Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in the ITS 2 - LSU interface (LSU positions – 2–18 in type species and S. cerevisiae aagtgatctgaaatcagaca; two mismatches allowed) and SSU V 8 (positions 1589–1608 in S. cerevisiae atgattcatcagatcatgct; two mismatches allowed). Forms a monophyletic, least inclusive clade in Savannolpidiomycetes, covering sequences EUK 1191209, EUK 1191210, EUK 0534704, EUK 1124874, EUK 1701673, EUK 1701672, and EUK 1124875 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Savannolpidiaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/8308B450488C50FEB24AE534FED886B0	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
E3DB8A3577075D3B9FA7A468A5225D7B.text	E3DB8A3577075D3B9FA7A468A5225D7B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Savannolpidiomycetes Tedersoo & Esmaeilzadeh-Salestani	<div><p>Savannolpidiomycetes Tedersoo &amp; Esmaeilzadeh-Salestani class. nov.</p><p>Type order.</p><p>Savannolpidiales Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 8 (positions 1546–1565 in S. cerevisiae gagcattgcaactattgctc; one mismatch allowed) and LSU D 2 (positions 525–534 in the type species and 472–481 in S. cerevisiae gtgcactttt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Olpidiomycota, covering sequences EUK 1191172, EUK 1191209, EUK 1191210, EUK 0534704, EUK 1701673, EUK 1701672, EUK 1124874, and EUK 1124875 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 93 J in EUKARYOME v 1.9. Currently harbors Savannolpidiales (ord. nov.) and potentially an order-level group represented by sequence EUK 1191172 (forest soil in Taiwan). Comprises potentially 50–70 species, which are difficult to delimit because of multiple indels rather than substitutions in the ITS region and no clear barcoding gap. Detected in soil (94.8 % out of the 191 records) and sediments (5.2 %) in tundra to hot tropical biomes across all continents except Antarctica. Relatively common in Europe (51.8 % of records) but less common in tropical biomes (15.7 %).</p></div>	https://treatment.plazi.org/id/E3DB8A3577075D3B9FA7A468A5225D7B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
532E9F06099A53DABA96D10380A0B08B.text	532E9F06099A53DABA96D10380A0B08B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Savannolpidium raadiense Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Savannolpidium raadiense Tedersoo &amp; Esmaeilzadeh-Salestani sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Savannolpidium based on ITS 2 (positions 16–40 agatctcatcttctttagagttggc; no mismatch allowed) and LSU (positions 468–492 tataaagggaggctagtgtgagcgc; no mismatch allowed) as indicated in Fig. 42. Intraspecific variation up to 1.6 % in ITS 2 and 0.9 % in LSU. Interspecific distance at least 2.8 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 002210 (holotype); eDNA sequence EUK 1124874 = OZ 253807 (legitype); eDNA sample TUE 102210 (nucleotype); GSMc plot G 5233, Populus balsamifera - dominated wasteland soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.7693&amp;materialsCitation.latitude=58.3972" title="Search Plazi for locations around (long 26.7693/lat 58.3972)">Raadi</a>, Estonia, 58.3972°N, 26.7693°E .</p><p>Description.</p><p>Other sequences: EUK 1138191 (type locality); EUK 1217298 (GSMc plot G 4777, flooded grassland soil Suur-Pakri Härs-hämani, Estonia, 59.3310°N, 23.9272°E); EUK 0332294 (GSMc plot G 5899, dry Juniperus shrubland soil in Virtsu, Estonia, 58.5775°N, 23.5547°E); EUK 0332296 (flooded grassland soil in Haanja, Estonia, 57.7165°N, 27.0549°E); EUK 0534754 (GSMc plot G 6107, Quercus woodland soil in Armishte, Iraqi Kurdistan, 37.0468°N, 42.8049°E); EUK 0584862 (FunAqua river sediment sample W 1356 s, Spey, Scotland, 57.0552, – 4.1276°E); EUK 0584863 (FunAqua saltwater sediment sample W 0938 s, Laguna di Orbetello, Italy, 42.4296°N, 11.1988°E).</p><p>Etymology.</p><p>Savanna (Taino) refers to treeless grasslands, and Raadi (Estonian) refers to the type locality.</p><p>Notes.</p><p>Found in grassy and disturbed habitats and aquatic sediments in Europe and the Middle East (n = 25 records). This is supported by 18 additional GlobalFungi records from agricultural and grassland soils in Europe.</p></div>	https://treatment.plazi.org/id/532E9F06099A53DABA96D10380A0B08B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
A04943B3E22E52C78C861297A3BE7DCA.text	A04943B3E22E52C78C861297A3BE7DCA.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Savannolpidium Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Savannolpidium Tedersoo &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Savannolpidium raadiense Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 121–135 in type species grtagtaaaagtagc; one mismatch allowed), SSU V 9 (positions 1684–1693 in S. cerevisiae ccttttttyg; one mismatch allowed), and LSU D 2 (positions 719–728 in type species and 604–613 in S. cerevisiae caaaaggatt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Savannolpidiaceae, covering sequences EUK 1124874 and EU 1191210 (Figs 1, 41).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises about 15–25 species represented by sequences EUK 1217296 (grassland soil in Austria), EUK 0034005 (forest soil in South Africa), EUK 0036392 (forest soil in South Africa), EUK 0034147 ( woodland soil in New Caledonia), EUK 0036996 (forest soil in Puerto Rico), EUK 0534723 (forest soil in South Africa), EUK 0534729 (forest soil in Spain), EUK 0036910 (forest soil in Estonia), and EUK 0534732 (forest soil in Iran).</p></div>	https://treatment.plazi.org/id/A04943B3E22E52C78C861297A3BE7DCA	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
055F6432250F57D3BED325D94E8A684C.text	055F6432250F57D3BED325D94E8A684C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sedimentomastigaceae Tedersoo 2025	<div><p>Sedimentomastigaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Sedimentomastix Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in SSU V 9 (positions 1672–1686 in S. cerevisiae ggcctccggattgat; no mismatch allowed) and LSU D 2 (positions 524–538 in type species and 460–474 in S. cerevisiae ttggtattttgggtg; three mismatches allowed). Forms a monophyletic, least inclusive clade in Sedimentomastigales, covering sequences EUK 0319782, EUK 0574067, EUK 0574066, EUK 1152060, and EUK 1191154 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently harbors Sedimentomastix (gen. nov.).</p></div>	https://treatment.plazi.org/id/055F6432250F57D3BED325D94E8A684C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
250D47DE755950B083F1EAC510C5E3BE.text	250D47DE755950B083F1EAC510C5E3BE.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sedimentomastigales Tedersoo 2025	<div><p>Sedimentomastigales Tedersoo ord. nov.</p><p>Type family.</p><p>Sedimentomastigaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1672–1686 in S. cerevisiae ggcctccggattgat; no mismatch allowed) and LSU D 2 (positions 524–538 in the type species and 460–474 in S. cerevisiae ttggtattttgggtg; three mismatches allowed). Forms a monophyletic, least inclusive clade in Sedimentomastigomycetes, covering sequences EUK 0319782, EUK 0574067, EUK 0574066, EUK 1152060, and EUK 1191154 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Sedimentomastigaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/250D47DE755950B083F1EAC510C5E3BE	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
8156049A2BED5A05B833C8AC1677D7F6.text	8156049A2BED5A05B833C8AC1677D7F6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sedimentomastigomycetes Tedersoo	<div><p>Sedimentomastigomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Sedimentomastigales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 9 (positions 1672–1686 in S. cerevisiae ggcctccggattgat; no mismatch allowed). Forms a monophyletic, least inclusive clade in Neocallimastigomycota, covering sequences EUK 0319782, EUK 0574067, EUK 0574066, EUK 1152060, and EUK 1191154 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 38 X in EUKARYOME v 1.9. Currently harbors Sedimentomastigales (ord. nov.). Comprises 5–6 potential species. Detected in sediments (50 % out of 10 records), freshwater (30 %), soil (10 %), and rotting algae (10 %) in tundra to tropical biomes in Eurasia, North America, and South America. The many records from sediments and flooded soils suggest that members of this class are facultative anaerobes.</p></div>	https://treatment.plazi.org/id/8156049A2BED5A05B833C8AC1677D7F6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
EC39DD3CA5E45017BB474111732DEEF5.text	EC39DD3CA5E45017BB474111732DEEF5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sedimentomastix Tedersoo 2025	<div><p>Sedimentomastix Tedersoo gen. nov.</p><p>Type species.</p><p>Sedimentomastix tueriensis Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1672–1686 in S. cerevisiae ggcctccggattgat; no mismatch allowed) and LSU D 2 (positions 524–538 in the type species and 460–474 in S. cerevisiae ttggtattttgggtg; two mismatches allowed). Forms a monophyletic, least inclusive clade in Sedimentomastigaceae, covering sequences EUK 0319782, EUK 0574067, EUK 0574066, EUK 1152060, and EUK 1191154 (Figs 1, 25).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises 5–6 potential species represented by sequences EUK 1191154 (rotting algae in Estonia), EUK 0319721 (river sediment in Germany), EUK 0319782 (lake sediment in Estonia), EUK 0574066 (lake sediment in Tibet), and EUK 0574067 (river sediment in Brazil).</p></div>	https://treatment.plazi.org/id/EC39DD3CA5E45017BB474111732DEEF5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
81A33060ABF4555C81C3ACA7380CDD24.text	81A33060ABF4555C81C3ACA7380CDD24.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sedimentomastix tueriensis Tedersoo 2025	<div><p>Sedimentomastix tueriensis Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Sedimentomastix based on ITS 2 (positions 15–34 ctaaaagtcgggtttgattt; one mismatch allowed) and LSU D 2 (positions 572–591 gaaacaatggataaagggca; one mismatch allowed) as indicated in Fig. 26. Intraspecific variation up to 1.7 % in ITS 2. Interspecific distance&gt; 15 % in ITS 2.</p><p>Type.</p><p>Wastewater sample TUE 032723 (holotype); eDNA sequence EUK 1152060 = OZ 253798 (legitype); eDNA sample TUE 132723 (nucleotype), <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=25.4067&amp;materialsCitation.latitude=58.8156" title="Search Plazi for locations around (long 25.4067/lat 58.8156)">Türi</a>, Estonia, 58.8156°N, 25.4067°E .</p><p>Description.</p><p>Other sequences: EUK 0302143 ( Populus tremula forest soil in Soinaste, Estonia, 58.3408°N, 26.6864°E); EUK 0584897 (FunAqua stream water sample in Kangilleq, Greenland, 60.8571, –46.4233); EUK 0584898 (FunAqua river water sample W 0597 w in Aveleda, Portugal, 41.8919, –6.6972); and EUK 0584899 (FunAqua lake sediment sample W 0307 s in Goldwin, ND, USA, 47.0996, –99.0916).</p><p>Etymology.</p><p>Sedimentomastix refers to sedimentum (the Latin term for sediment) and Neocallimastix; the epithet refers to Türi (Estonian), the type locality.</p><p>Notes.</p><p>Found in water, sediment, and soil samples in Europe and North America (n = 5 records). GlobalFungi includes nine additional records, mainly from wetland soils in Europe, Asia, and North America.</p></div>	https://treatment.plazi.org/id/81A33060ABF4555C81C3ACA7380CDD24	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
6DD4E2A76002570CB923F64DED31CFC5.text	6DD4E2A76002570CB923F64DED31CFC5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Solivoracaceae Tedersoo 2025	<div><p>Solivoracaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Solivorax Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions in type species gctaagttta; two mismatches allowed) and LSU D 2 (positions 694–703 in type species and 596–605 in S. cerevisiae ctaacgtgct; one mismatch allowed). Forms a monophyletic, least inclusive clade in Solivoracales, covering sequences OQ 687305, OQ 687310, OQ 687311, EUK 1216850, DQ 244008, UDB 014650, EUK 1124454, EUK 1216854, EUK 1216849, and OQ 687309 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Solivorax (gen. nov.) and other potentially genus-level groups represented by sequences OQ 687305 (lake water in MI, USA), OQ 687310 (lake water in MI, USA), OQ 687311 (lake water in MI, USA), EUK 1216850 (lake sediment in Benin), and DQ 244008 (lake water in France).</p></div>	https://treatment.plazi.org/id/6DD4E2A76002570CB923F64DED31CFC5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
7CB6B20299DA52B3BA5AC25BE06DF806.text	7CB6B20299DA52B3BA5AC25BE06DF806.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Solivoracales Tedersoo 2025	<div><p>Solivoracales Tedersoo ord. nov.</p><p>Type family.</p><p>Solivoracaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 694–703 in type species and 596–605 in S. cerevisiae ctaacgtgct or cctttgtgct; one mismatch allowed). Forms a monophyletic, least inclusive clade in Algovoracomycetes, covering sequences OQ 687305, OQ 687310, OQ 687311, EUK 1216850, DQ 244008, UDB 014650, EUK 1124454, EUK 1216854, EUK 1216849, and OQ 687309 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Solivoracaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/7CB6B20299DA52B3BA5AC25BE06DF806	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
24CB805A51775C519CD4DB95B1B27B14.text	24CB805A51775C519CD4DB95B1B27B14.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Solivorax pantropicus Tedersoo 2025	<div><p>Solivorax pantropicus Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Solivorax based on ITS 2 (positions 273–292 gtctgaccgaaatatctgaa; one mismatch allowed) and LSU D 2 (positions 672–691 gcctgctatgctagcgccgc; one mismatch allowed) as indicated in Fig. 16. Intraspecific variation up to 2.4 % in ITS 2. Interspecific distance at least 8.2 % in ITS 2 and 6.2 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 000167 (holotype); eDNA sequence UDB 014650 = OZ 253792 (legitype); eDNA sample TUE 100167 (nucleotype); GSMc plot G 2750, tropical forest soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=131.4395&amp;materialsCitation.latitude=-13.7655" title="Search Plazi for locations around (long 131.4395/lat -13.7655)">Douglas Hot Springs</a>, NT, Australia, –13.7655, 131.4395 .</p><p>Description.</p><p>Other sequences: EUK 0484226 (GSMc plot S 1278, Eucalyptus plantation soil near Durban, South Africa, –29.7502, 30.7419); EUK 0331319 (GSMc plot G 5027, subtropical swamp forest soil in Deweyville, LO, USA, 30.3076°N, 93.7304°E); EUK 0331320 (GSMc plot S 915, tropical dry forest soil in Rancho Calimayor, Mexico, 16.5461, –93.8828); EUK 0331312 (GSMc plot G 5687, tropical garden soil in Kakamega, Kenya, 0.2866°N, 34.7673°E); EUK 0331316 (GSMc plot JYK 054, Eucalyptus plantation soil in Bome, Liberia, 6.5245, –10.8400); EUK 0331318 (GSMc plot S 1267, tropical rainforest soil in Khong Ngam, Thailand, 19.6691°N, 99.8199°E); and EUK 0331314 (GSMc plot G 5068, tropical rainforest soil in Quixada, Brazil, 4.8876, –39.0461).</p><p>Etymology.</p><p>Solum and vorax (Latin) refer to soil devouring, and pantropicos (Greek) refers to widespread distribution across tropical regions.</p><p>Notes.</p><p>Found in tropical and subtropical forest soils worldwide (n = 23 records). The 17 additional GlobalFungi records confirm the tropical distribution and indicate potential colonization of plant roots (2 records).</p></div>	https://treatment.plazi.org/id/24CB805A51775C519CD4DB95B1B27B14	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
4BAB13E32D145F278C95563FCC10068D.text	4BAB13E32D145F278C95563FCC10068D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Solivorax Tedersoo 2025	<div><p>Solivorax Tedersoo gen. nov.</p><p>Type species.</p><p>Solivorax pantropicus Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in ITS 2 (positions 85–102 in type species gtaccgctaagtttaagc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Solivoracaceae, covering sequences UDB 014650, EUK 1124454, EUK 1216854, EUK 1216849, and OQ 687309 (Figs 1, 14).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises about 60 species represented by sequences EUK 1124454 (forest soil in Estonia), EUK 1216854 (forest soil in Czechia), EUK 1216849 (wetland soil in Estonia), OQ 687309 (lake water in MI, USA), EUK 0484219 (forest soil in Thailand), KX 514861 (rainwater in China), EUK 0331291 ( woodland soil in Brazil), EUK 0331301 (forest soil in Czechia), and EUK 0484210 (grassland soil in Estonia).</p></div>	https://treatment.plazi.org/id/4BAB13E32D145F278C95563FCC10068D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
023AAF1BB47D52E7BB9E82FD194D8C37.text	023AAF1BB47D52E7BB9E82FD194D8C37.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Spizellomycetes Tedersoo, Sanchez-Ramirez, Koljalg, Bahram, M. Doring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Spizellomycetes Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 149 (2018)</p><p>Type order.</p><p>Spizellomycetales D. J. S. Barr.</p><p>Description.</p><p>As in Tedersoo et al. (2018).</p><p>Notes.</p><p>Currently harbors Spizellomycetales and Paraspizellomycetales (ord. nov.).</p></div>	https://treatment.plazi.org/id/023AAF1BB47D52E7BB9E82FD194D8C37	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
352963399E315BD4A4A5F8B5BE91F994.text	352963399E315BD4A4A5F8B5BE91F994.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sumavosporidiaceae Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Sumavosporidiaceae Tedersoo &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Sumavosporidium Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 124–138 in the type species and 125–139 in S. cerevisiae gcaatcygcaggcat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Sumavosporidiales, covering sequences UDB 029033, UDB 029043, UDB 029027, UDB 028954, EUK 1104656, EUK 1106151, and EUK 1104875 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Sumavosporidium (gen. nov.).</p></div>	https://treatment.plazi.org/id/352963399E315BD4A4A5F8B5BE91F994	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3A792B941CDB5E6EA9CBC500633FB3B4.text	3A792B941CDB5E6EA9CBC500633FB3B4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sumavosporidiales Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Sumavosporidiales Tedersoo &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Sumavosporidiaceae Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 6 (positions 1157–1176 in S. cerevisiae acaccaaaagtggattttgc or acaccaagagtggagcatgc or acacaagaagtggagcctgc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Sumavosporidiomycetes, covering sequences EUK 1206927, EUK 1202246, EUK 1200658, UDB 029033, EUK 1105717, EUK 1107386, EUK 1106576, EUK 1101061, and EUK 1101529 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Sumavosporidiaceae (fam. nov.) and several potentially family-level groups represented by sequences EUK 1206927 (marine sediment in Norway), EUK 1202246 (river sediment in Slovenia), EUK 1200658 (forest soil in Bulgaria), EUK 1101529 (forest soil in Sweden), EUK 1105717 (forest soil in Sweden), and EUK 1101061 (mixed soil in Tibet).</p></div>	https://treatment.plazi.org/id/3A792B941CDB5E6EA9CBC500633FB3B4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
38C0201E8A1C582AAB5FD2F35ED529AA.text	38C0201E8A1C582AAB5FD2F35ED529AA.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sumavosporidiomycetes Tedersoo & Esmaeilzadeh-Salestani	<div><p>Sumavosporidiomycetes Tedersoo &amp; Esmaeilzadeh-Salestani class. nov.</p><p>Type order.</p><p>Sumavosporidiales Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in SSU V 6 (positions 1153–1167 gagcacaccaaragt or gacgacacaagaagt in S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Rozellomycota, covering sequences EUK 1206927, EUK 1202246, EUK 1200658, UDB 029033, EUK 1105717, EUK 1107386, EUK 1106576, EUK 1101061, and EUK 1101529 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 01 in EUKARYOME v 1.9. Previously considered a distinct phylum-level lineage, but inclusive taxon sampling in Rozellomycota places Sumavosporidiomycetes in this phylum. Currently harbors Sumavosporidiales (ord. nov.). Comprises potentially 800–1050 species. Members of this class have been detected from soil (99.5 % out of 4122 records), sediments (0.3 %), and water (0.1 %). Recorded from high arctic to hot tropical biomes across all continents, including Antarctica.</p></div>	https://treatment.plazi.org/id/38C0201E8A1C582AAB5FD2F35ED529AA	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2E70C63A1BB053A5B3FC3A332E8A0A5A.text	2E70C63A1BB053A5B3FC3A332E8A0A5A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sumavosporidium sylvestre Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Sumavosporidium sylvestre Tedersoo &amp; Esmaeilzadeh-Salestani sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Sumavosporidium based on ITS 2 (positions 7–31 gaatgaagatgtgatcgaactgtgc; one mismatch allowed) and LSU (positions 465–484 caactagttggccttcaggt; one mismatch allowed) as indicated in Fig. 46. Intraspecific variation up to 2.0 % in ITS 2 and up to 0.2 % in LSU. Interspecific distance at least 12.0 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 000381 (holotype); eDNA sequence UDB 029033 = OZ 253808 (legitype); eDNA sample TUE 100381 (nucleotype); GSMc plot S 114, Picea abies dominated forest soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=13.4751&amp;materialsCitation.latitude=49.017" title="Search Plazi for locations around (long 13.4751/lat 49.017)">Šumava</a>, Czechia, 49.017°N, 13.4751°E .</p><p>Description.</p><p>Other sequences: UDB 014611 and EUK 0482169 (type locality); UDB 029027, UDB 029028 and UDB 014612 (GSMc plot S 121, Fagus sylvatica forest soil in Taunus, Germany, 50.1413°N, 8.2677°E); EUK 0482019 and EUK 0520242 (GSMc plot S 426, Fagus sylvatica forest soil in Kistrupvang, Denmark, 56.0264°N, 12.3364°E); HQ 022097 (mixed forest soil in Bartlett Experimental Forest, NH, USA, 44.06, – 71.30); EUK 0522425 and EUK 0522433 and (GSMc plot G 4145, mixed deciduous forest soil in Promised Land, PA, USA, 41.30491, – 75.2021°E); EUK 0523233 (GSMc plot S 878, Alnus alnobetula tundra soil in Anadyr, Chukotka, Russia, 64.7219°N, 177.4238°E); EUK 0034322 (GSMc plot G 4713, Tsuga mertensiana forest soil in Crater Lake, OR, USA, 42.9786, – 122.13); and EUK 0521849 (GSMc plot S 892, forest tundra soil in Arman, Magadan, Russia, 59.6972°N, 150.4118°E).</p><p>Etymology.</p><p>Šumava (Czech) refers to the type locality, and sylva (Latin) refers to the forest habitat.</p><p>Notes.</p><p>Found in eight localities in acidic temperate and boreal forest and tundra soils in Europe, Asia, and North America. GlobalFungi reveals seven additional records from forest soil in Europe and one record from an Indonesian oil palm plantation soil.</p></div>	https://treatment.plazi.org/id/2E70C63A1BB053A5B3FC3A332E8A0A5A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
006E10ABBF53574BB8D6111E43179016.text	006E10ABBF53574BB8D6111E43179016.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Sumavosporidium Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Sumavosporidium Tedersoo &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Sumavosporidium sylvestre Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in 5.8S (positions 124–138 in the type species and 125–139 in S. cerevisiae gcaatcygcaggcat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Sumavosporidiaceae, covering sequences UDB 029033, UDB 029043, UDB 029027, UDB 028954, and EUK 1104656 (Figs 1, 45).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially 160–180 species represented by sequences UDB 029043 (forest soil in Argentina), UDB 028927 ( woodland soil in Greece), UDB 029030 (forest soil in Scotland), EUK 1104656 (forest soil in Sweden), EUK 0481687 (grassland soil in Norway), EUK 1106151 (peatland soil in Sweden), UDB 028954 (forest soil in Argentina), EUK 0481807 (forest soil in Argentina), EUK 0022003 (forest soil in OR, USA), EUK 0481723 (forest soil in Magadan, Russian Federation), and EUK 0481554 (forest soil in Chukotka, Russian Federation).</p></div>	https://treatment.plazi.org/id/006E10ABBF53574BB8D6111E43179016	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
628A60FCB5055A1D867B4E2A35FE1DD4.text	628A60FCB5055A1D867B4E2A35FE1DD4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tartumyces setoi Tedersoo 2025	<div><p>Tartumyces setoi Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Tartumyces based on ITS 2 (positions 310–329 ggggggtataaaaactcgtt; one mismatch allowed) and LSU D 2 (positions 518–539 tattcgccggataatggtac; no mismatch allowed) as indicated in Fig. 62. Intraspecific variation up to 2.8 % in ITS 2. Interspecific distance at least 4.5 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 002210 (holotype); eDNA sequence EUK 1123648 = OZ 253817 (legitype); eDNA sample TUE 102210 (nucleotype); GSMc plot G 5233, wasteland in Tartu, Estonia, 58.3972°N, 26.7693°E .</p><p>Description.</p><p>Other sequences: EUK 1703744 (GSMc plot G 4372, mixed forest soil in Kiisli, Estonia, 58.6955°N, 26.9128°E); EUK 1703739 (GSMc plot G 3569, Quercus robur park soil in Äksi, Estonia, 58.5290°N, 26.6385°E); and EUK 1703737 (GSMc plot G 3413, Salix caprea forest soil in Väägvere, Estonia, 58.4389°N, 26.8976°E).</p><p>Etymology.</p><p>&gt; Tartu (Estonian) refers to the city and county in Estonia, where the type material and most other specimens were collected. The epithet refers to Kensuke Seto, the first to obtain coarse single-cell photographs of species belonging to this phylum (Seto et al. 2023).</p><p>Notes.</p><p>Found in soil in Estonia (n = 4 records). An additional record in GlobalFungi also indicates occurrence in Estonian plantation soil.</p></div>	https://treatment.plazi.org/id/628A60FCB5055A1D867B4E2A35FE1DD4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
00ECABB66B0C5FF0A9629C819B8D84CF.text	00ECABB66B0C5FF0A9629C819B8D84CF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tartumyces Tedersoo 2025	<div><p>Tartumyces Tedersoo gen. nov.</p><p>Type species.</p><p>Tartumyces setoi Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 289–300 in type species gggtttgcaaac, one mismatch allowed) and LSU D 4 (positions 624–633 in type species and 601–610 in S. cerevisiae gaatttattc, one mismatch allowed). Forms a monophyletic, least inclusive clade in Tartumycetaceae, covering sequences EUK 1123648 and EUK 1138300 (Figs 1, 61).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises around 10 potential species.</p></div>	https://treatment.plazi.org/id/00ECABB66B0C5FF0A9629C819B8D84CF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
E8A6F21799655ACE93B423E828402B65.text	E8A6F21799655ACE93B423E828402B65.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tartumycetaceae Tedersoo 2025	<div><p>Tartumycetaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Tartumyces Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 173–187 in type species ggaaagcgtagtagg, two mismatches allowed) and LSU D 4 (positions 1439–1453 in type species and 1404–1418 in S. cerevisiae gatgccgcgtcgaac, one mismatch allowed). Forms a monophyletic, least inclusive clade in Tartumycetales, covering sequences EUK 1123648, EUK 1138300, EUK 1186160, EUK 1186168, and EUK 1186172 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Tartumyces (gen. nov.) and several potentially genus-level taxa represented by sequences EUK 1186160 (forest soil in Dominica), EUK 1186168 (forest soil in Udmurtia), and EUK 1186172 (forest soil in Italy).</p></div>	https://treatment.plazi.org/id/E8A6F21799655ACE93B423E828402B65	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
082BFA7199D450DEAA6CAF8F0A69374A.text	082BFA7199D450DEAA6CAF8F0A69374A.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tartumycetales Tedersoo 2025	<div><p>Tartumycetales Tedersoo ord. nov.</p><p>Type family.</p><p>Tartumycetaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 120–129 in type species gaaccaaagg, one mismatch allowed) and LSU D 1 (positions 164–178 in type species and 161–175 in S. cerevisiae gatgcctgtgggagc, one mismatch allowed). Forms a monophyletic, least inclusive clade in Tartumycetes, covering sequences EUK 1186157, EUK 1200073, EUK 1186162, EUK 1123648, EUK 1138300, OQ 702816, ON 754309, UDB 028835, and HQ 191300 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Tartumycetaceae and several potentially family-level groups represented by sequences EUK 1186157 (forest soil in Puerto Rico), EUK 1200073 (tundra soil in Finland), EUK 1186162 (rotting algal sample in Estonia), OQ 702816 (algal sample in MI, USA), ON 754309 (river sediment in China), UDB 028835 (lake water in Germany), and HQ 191300 (lake water in France).</p></div>	https://treatment.plazi.org/id/082BFA7199D450DEAA6CAF8F0A69374A	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
0E6A3AF0B186574EAFC3CB2585907523.text	0E6A3AF0B186574EAFC3CB2585907523.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tartumycetes Tedersoo	<div><p>Tartumycetes Tedersoo class. nov.</p><p>Type order.</p><p>Tartumycetales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 4 (positions 1439–1453 in type species and 1404–1418 in S. cerevisiae gatgccgcgtcgaac, one mismatch allowed). Forms a monophyletic, least inclusive clade in Tartumycota, covering sequences EUK 1186157, EUK 1200073, EUK 1186162, EUK 1123648, EUK 1138300, OQ 702816, ON 754309, UDB 028835 and HQ 191300 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA and single-cell sequences only. Currently harbors Tartumycetales (ord. nov.).</p></div>	https://treatment.plazi.org/id/0E6A3AF0B186574EAFC3CB2585907523	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
D0475B58916D5516A0EAA122F9DA3B69.text	D0475B58916D5516A0EAA122F9DA3B69.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tartumycota Tedersoo 2025	<div><p>Tartumycota Tedersoo phyl. nov.</p><p>Type class.</p><p>Tartumycetes Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 3 (positions 1009–1023 in the type species and 969–983 in S. cerevisiae ggaacttgtacagtt, no mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences OQ 702815, EUK 1186161, OQ 687331, EUK 1186165, EUK 1186157, EUK 1200073, EUK 1186162, EUK 1123648, EUK 1138300, OQ 702816, ON 754309, UDB 028835, and HQ 191300 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA and single-cell sequences only. Encoded as “ freshol 1 ” and clade BCG 2 in previous studies and EUKARYOME v 1.9. Currently harbors Tartumycetes (class. nov.) and potentially a class-level group represented by sequences OQ 687331 (lake water in MI, USA), OQ 702815 (algal sample in MI, USA), EUK 1186161, and EUK 1186165 (both rotting algae in Estonia). Comprises potentially 100–110 species. Detected in soil (64.9 % out of 296 records), water (22.0 %), sediments (8.8 %), and algae (4.4 %) in tundra to hot tropical biomes across all continents except Antarctica. Microscopic analyses of freshwater algae suggest parasitic interactions. It is possible that Tartumycota spp. are parasitic on soil and aquatic algae.</p></div>	https://treatment.plazi.org/id/D0475B58916D5516A0EAA122F9DA3B69	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
92F02C2B343D50158C6102449E3D9EF9.text	92F02C2B343D50158C6102449E3D9EF9.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Terrincola Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Terrincola Tedersoo &amp; Esmaeilzadeh-Salestani gen. nov.</p><p>Type species.</p><p>Terrincola waldropii Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in ITS 2 (positions 23–32 ggccgtacgg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Terrincolaceae, covering sequences MW 791967, EUK 0473585, and EUK 1138132 (Figs 1, 27).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially four species represented by sequences EUK 0473585 (shrubland soil in Uyghur Autonomous Region, China), EUK 1604143 (forest soil in VT, USA), and EUK 1604137 (forest soil in South Africa).</p></div>	https://treatment.plazi.org/id/92F02C2B343D50158C6102449E3D9EF9	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
75FB219161D0507C8807A426187E95D5.text	75FB219161D0507C8807A426187E95D5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Terrincola waldropii Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Terrincola waldropii Tedersoo &amp; Esmaeilzadeh-Salestani sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Terrincola based on diagnostic nucleotide signatures in ITS 2 (positions 359–383 atagatgggacccggtcgaggatca; one mismatch allowed) and LSU D 2 (positions 569–588 agtcctctatttgtacaatg; one mismatch allowed) as indicated in Fig. 28. Intraspecific variation up to 1.2 % in ITS 2 and up to 0.5 % in LSU sequences. Interspecific distance at least 4.9 % in ITS 2 and 3.9 % in LSU.</p><p>Type.</p><p>Vouchered soil sample TUE 000813 (holotype); DNA sequence EUK 1138132 = OZ 253800 (legitype); eDNA sample TUE 100813 (nucleotype); GSMc plot S 281, Quercus robur alley in Tartu, Estonia, 58.379°N, 26.706°E .</p><p>Description.</p><p>Other sequences: EUK 1138131 (GSMc plot G 5295, Pinus mugo plantation soil in Märja, Estonia, 58.3592°N, 26.6443°E); EUK 0326024 (GSMc plot S 1087, tundra soil in Zackenberg, Greenland, 74.4682, –20.6142); EUK 0326022 (GSMc plot G 5038, tropical dry forest soil in West End, British Virgin Islands, 18.3907, –64.7073); EUK 0326084 (GSMc plot S 639, subtropical forest soil in Platbos, South Africa, –34.5676, 19.4461); EUK 0326080 (GSMc plot S 618, montane desert soil in Tanglang La, India, 33.5051°N, 77.7655°E); EUK 0326071 (GSMc plot G 5769, temperate grassland soil in Rõõmu, Estonia, 58.3877°N, 26.7770°E); and DQ 421306 (temperate grassland soil in Cedar Creek, MN, USA, 45.40, – 93.19).</p><p>Etymology.</p><p>Terra and incola (Latin) refer to the soil habitat, and Waldrop (English) refers to the last name of Mark P. Waldrop, who was the first to collect material of this species and order (DQ 421306; Waldrop et al. 2006).</p><p>Notes.</p><p>All 109 records originate from soil. This is supported by GlobalFungi data, where&gt; 98 % of 732 records are from soil and 1 % from roots. Found in all biomes and continents, excluding Antarctica.</p></div>	https://treatment.plazi.org/id/75FB219161D0507C8807A426187E95D5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
E4BE1CA3D6EC5C598491277CCC6A32FF.text	E4BE1CA3D6EC5C598491277CCC6A32FF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Terrincolaceae Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Terrincolaceae Tedersoo &amp; Esmaeilzadeh-Salestani fam. nov.</p><p>Type genus.</p><p>Terrincola Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other members of Calcarisporiellomycota based on diagnostic nucleotide signature in ITS 2 (positions 285–292 aaaatrtt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Terrincolales, covering sequences MW 791967, EUK 1138132, EUK 1123677, EUK 0332618, EUK 1123675, and EUK 1123676 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Terrincola (gen. nov.) and several potentially genus-level groups represented by sequences EUK 1123677 (forest soil in Estonia), EUK 0332618 (forest soil in Colombia), EUK 1123675 (wasteland soil in Estonia), and EUK 1123676 (garden soil in Estonia).</p></div>	https://treatment.plazi.org/id/E4BE1CA3D6EC5C598491277CCC6A32FF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
BCA3DB630FC95F7D9479CA4F0F8FB536.text	BCA3DB630FC95F7D9479CA4F0F8FB536.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Terrincolales Tedersoo & Esmaeilzadeh-Salestani 2025	<div><p>Terrincolales Tedersoo &amp; Esmaeilzadeh-Salestani ord. nov.</p><p>Type family.</p><p>Terrincolaceae Tedersoo &amp; Esmaeilzadeh-Salestani .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in 5.8S (positions 6–26 in type species and S. cerevisiae ttcaacaatggatccctcg; no mismatch allowed), LSU D 1 (positions 4–23 in type species and S. cerevisiae tcctcaaatcaagcaagagt; no mismatch allowed), LSU D 2 (positions 255–264 in type species and 244–253 in S. cerevisiae ttggtagtgg; one mismatch allowed), and SSU V 3 (positions 647–651 ggcttg in S. cerevisiae; no mismatch allowed). Forms a monophyletic, least inclusive clade in Calcarisporiellomycetes, covering sequences MW 791967, EUK 1138132, EUK 1123677, EUK 0332618, EUK 1123675, EUK 1604147, EUK 1604155, and EUK 1123676 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 94 in EUKARYOME v 1.9. Currently includes Terrincolaceae (fam. nov.) and a potentially family-level group represented by sequences EUK 1604147 (tundra soil in AK, USA) and EUK 1604155 (forest soil in LO, USA). Terrincolales comprises potentially 50–70 species. Detected exclusively in soil (100 % out of the 249 records) in tundra to hot tropical biomes across all continents, excluding Antarctica.</p></div>	https://treatment.plazi.org/id/BCA3DB630FC95F7D9479CA4F0F8FB536	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
29B6676850255C88ACB2924703FD0A6C.text	29B6676850255C88ACB2924703FD0A6C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tibetochytriaceae Tedersoo 2025	<div><p>Tibetochytriaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Tibetochytrium Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 722–736 in S. cerevisiae gtgggttagggatcc; one mismatch allowed), 5.8S (positions 120–134 in type species and S. cerevisiae gctggtattccggcg; one mismatch allowed), and LSU D 2 (positions 505–619 in type species and 600–614 in S. cerevisiae ggcttagctggatac; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tibetochytriales, covering sequences EUK 1186747, EUK 1123755, and EUK 1186750 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Tibetochytrium (gen. nov.) and another potentially genus-level group represented by the sequence EUK 1186747 (forest soil in Yunnan, China).</p></div>	https://treatment.plazi.org/id/29B6676850255C88ACB2924703FD0A6C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
B1584609431355B984D9CCE38CE198A1.text	B1584609431355B984D9CCE38CE198A1.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tibetochytriales Tedersoo 2025	<div><p>Tibetochytriales Tedersoo ord. nov.</p><p>Type family.</p><p>Tibetochytriaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 722–736 in S. cerevisiae gtgggttagggatcc or gtgggttagggagct; one mismatch allowed), 5.8S (positions 120–134 in type species and S. cerevisiae gctggtattccggcg or tttggtatcccgaag; one mismatch allowed), and LSU D 2 (positions 505–619 in type species and 600–614 in S. cerevisiae ggcttagctggatac or agcttttgcagggat; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tibetochytriomycetes, covering sequences EUK 1186747, EUK 1123755, EUK 1186750, EUK 1102822, and EUK 1186746 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Tibetochytriaceae (fam. nov.) and another potentially family-level group represented by sequences EUK 1102822 and EUK 1186746 (both forest soil in Puerto Rico).</p></div>	https://treatment.plazi.org/id/B1584609431355B984D9CCE38CE198A1	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
88EC7C3A54845D7992EDEFCFDC2FA99E.text	88EC7C3A54845D7992EDEFCFDC2FA99E.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tibetochytriomycetes Tedersoo	<div><p>Tibetochytriomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Tibetochytriales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 722–736 in S. cerevisiae gtgggttagggatcc or gtgggttagggagct; one mismatch allowed), 5.8S (positions 120–134 in type species and S. cerevisiae gctggtattccggcg or tttggtatcccgaag; one mismatch allowed), and LSU D 2 (positions 505–619 in type species and 600–614 in S. cerevisiae ggcttagctggatac or agcttttgcagggat; two mismatches allowed). Forms a monophyletic, least inclusive clade in Chytridiomycota, covering sequences EUK 1186747, EUK 1123755, EUK 1186750, EUK 1102822, and EUK 1186746 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 43 in EUKARYOME v 1.9. Currently harbors Tibetochytriales (ord. nov.). Comprises around five potential species. Detected in soil (91.6 % out of the 24 records), once in roots, and once in sediments. Found in tundra to wet tropical biomes across all continents except Antarctica.</p></div>	https://treatment.plazi.org/id/88EC7C3A54845D7992EDEFCFDC2FA99E	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
4499B23FFEAB5A70AE9ABE273C68F07B.text	4499B23FFEAB5A70AE9ABE273C68F07B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tibetochytrium taylorii Tedersoo 2025	<div><p>Tibetochytrium taylorii Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Tibetochytrium based on ITS 2 (positions 85–104 ttggctatatctcgctttga; one mismatch allowed) and LSU (positions 656–675 ctgattgtcagtggagccat; no mismatch allowed) as indicated in Fig. 11. Intraspecific variation up to 3.8 % in ITS 2 and up to 1.0 % in LSU. Interspecific distance&gt; 20 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 002260 (holotype); eDNA sequence EUK 1123755 = OZ 253790 (legitype); eDNA sample TUE 102260 (nucleotype); GSMc plot G 5283; Quercus robur plantation soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=26.5943&amp;materialsCitation.latitude=58.3845" title="Search Plazi for locations around (long 26.5943/lat 58.3845)">Rahinge</a>, Estonia, 58.3845°N, 26.5943°E) .</p><p>Description.</p><p>Other sequences: EUK 1186749 (GSMc plot S 949; boreal coniferous forest soil in Mt. Mayak, Altai, Russian Federation, 51.0443°N, 82.9694°E); EUK 1186750 (GSMc plot S 958, temperate broadleaf forest soil in Měšice, Czechia, 50.2006°N, 14.5284°E); EUK 1186752 (GSMc plot S 966; temperate broadleaf forest soil in Orlík nad Vltavou, Czechia, 49.5002°N, 14.1742°E); OW 841378 (unspecified soil in Tianshan Mountains, Uyghuria, China); MW 215915 (rhizosphere soil in Lithuania); EF 434111 (boreal forest soil in Bonanza Creek, AK, USA); EUK 0519405 (GSMc plot S 1406, grassland soil in Chuy, Kyrgyzstan, 42.5502°N, 74.5121°E); GU 311731 (grassland soil in KS, USA); OX 032019 ( Festuca brevipila roots in temperate grassland, Mallnow, Germany).</p><p>Etymology.</p><p>Tibet (Tibetan) refers to the region of the type habitat, and Taylor (English) refers to the last name of D. Lee Taylor, who was the first to collect material of this species (EF 434111; Taylor et al. 2007).</p><p>Notes.</p><p>The 18 records indicate occurrence mainly in soil (88.9 %), with single findings in roots and sediments. Distribution in temperate Eurasia, with two records from North America. The 140 additional GlobalFungi records confirm the soil habitat (97.9 %) but extend the distribution to temperate Australia, New Zealand, and Patagonia.</p></div>	https://treatment.plazi.org/id/4499B23FFEAB5A70AE9ABE273C68F07B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
2DE7214597C355DD8A88082191CDECB6.text	2DE7214597C355DD8A88082191CDECB6.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tibetochytrium Tedersoo 2025	<div><p>Tibetochytrium Tedersoo gen. nov.</p><p>Type species.</p><p>Tibetochytrium taylorii Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in ITS 2 (positions 100–119 in type species ttgacagacttacgcgtctt; two mismatches allowed), LSU D 2 (positions 552–571 in type species and 547–566 in S. cerevisiae aaagtgttatagcttttcat; two mismatches allowed), and SSU V 9 (positions 1700–1714 in S. cerevisiae caacgaaaatagatt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tibetochytriaceae, covering sequences EUK 1123755 and EUK 1186750 (Figs 1, 10).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises a single species, Tibetochytrium taylorii (sp. nov.).</p></div>	https://treatment.plazi.org/id/2DE7214597C355DD8A88082191CDECB6	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
E98E6ABF02375E69BFD6009170375C7B.text	E98E6ABF02375E69BFD6009170375C7B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tropicochytriaceae Tedersoo 2025	<div><p>Tropicochytriaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Tropicochytrium Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 841–850 in S. cerevisiae tccgggracc; no mismatch allowed) and LSU D 2 (positions 598–607 in the type species and 592–601 in S. cerevisiae agcagcgctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tropicochytriales, covering sequences EUK 1102342, EUK 1186762, EUK 1100009, EUK 1186758, EUK 0519487, EUK 1186756, and EUK 1102527 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Tropicochytrium (gen. nov.) and other potentially genus-level groups represented by sequences EUK 1102342, EUK 1186762, EUK 1102527, and EUK 1100009 (all forest soil in Puerto Rico).</p></div>	https://treatment.plazi.org/id/E98E6ABF02375E69BFD6009170375C7B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
862DE849425A57518C0E005AB0B227E3.text	862DE849425A57518C0E005AB0B227E3.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tropicochytriales Tedersoo 2025	<div><p>Tropicochytriales Tedersoo ord. nov.</p><p>Type family.</p><p>Tropicochytriaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 841–850 in S. cerevisiae tccgggracc; no mismatch allowed) and LSU D 2 (positions 598–607 in the type species and 592–601 in S. cerevisiae agcagcgctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tropicochytriomycetes, covering sequences EUK 1102342, EUK 1186762, EUK 1100009, EUK 1186758, EUK 0519487, EUK 1186756, and EUK 1102527 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Tropicochytriaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/862DE849425A57518C0E005AB0B227E3	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
C9A27E99923A52A89A23890C55A5F4AF.text	C9A27E99923A52A89A23890C55A5F4AF.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tropicochytriomycetes Tedersoo	<div><p>Tropicochytriomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Tropicochytriales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 4 (positions 841–850 in S. cerevisiae tccgggracc; no mismatch allowed) and LSU D 2 (positions 598–607 in the type species and 592–601 in S. cerevisiae agcagcgctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Chytridiomycota, covering sequences EUK 1102342, EUK 1186762, EUK 1100009, EUK 1186758, EUK 0519487, EUK 1186756, and EUK 1102527 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 60 in EUKARYOME v 1.9. Currently harbors Tropicochytriales (ord. nov.). Comprises potentially around 220–230 species. Detected in soil (98.0 % out of the 299 records) and sediments (2.0 %). Found in warm temperate to tropical biomes across all continents (except Antarctica), especially in neotropical habitats (46.3 % of records). Only 3.0 % of records originate from cool temperate localities (in Europe).</p></div>	https://treatment.plazi.org/id/C9A27E99923A52A89A23890C55A5F4AF	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
B5DD887FEC7E5FD6849069B66C9792E2.text	B5DD887FEC7E5FD6849069B66C9792E2.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tropicochytrium Tedersoo 2025	<div><p>Tropicochytrium Tedersoo gen. nov.</p><p>Type species.</p><p>Tropicochytrium toronegroense Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signature in ITS 2 (positions 108–127 in type species ctcgtggtccgcaaggcttt; one mismatch allowed) and LSU D 2 (positions 557–577 in type species and 549–569 in S. cerevisiae agtttatagcctccggtcctg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Tropicochytriaceae, covering sequences EUK 1186758, EUK 0519487, and EUK 1186756 (Figs 1, 12).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises potentially 20–25 species represented by sequences EUK 0519487 (forest soil in the Philippines), EUK 1186758 (forest soil in Guadeloupe), EUK 1186753 (forest soil in Puerto Rico), and EUK 0131338 (grassland soil in Colombia).</p></div>	https://treatment.plazi.org/id/B5DD887FEC7E5FD6849069B66C9792E2	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
BC7695C5B463568B95622A35EEAE9C2D.text	BC7695C5B463568B95622A35EEAE9C2D.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tropicochytrium toronegroense Tedersoo 2025	<div><p>Tropicochytrium toronegroense Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Tropicochytrium based on ITS 2 (positions 182–201 gggggcctcgtctccccttt; one mismatch allowed) and LSU D 2 (positions 536–555 gaccccgccctcacgggtgg; no mismatch allowed) as indicated in Fig. 13. Intraspecific variation up to 2.1 % in ITS 2. Interspecific distance at least 3.1 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 002012 (holotype); eDNA sequence EUK 1186756 = OZ 253791 (legitype); eDNA sample TUE 102012 (nucleotype); GSMc plot G 5035; tropical rainforest soil in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-66.4884&amp;materialsCitation.latitude=18.177" title="Search Plazi for locations around (long -66.4884/lat 18.177)">Toro Negro</a>, Puerto Rico, 18.1770, –66.4884 .</p><p>Description.</p><p>Other sequences: EUK 0649723 (GSMc plot MX 35, Pinus chiapensis - dominated tropical forest, Mecacalvo, Veracruz, Mexico, 19.7760, –97.1016); EUK 0649724 (GSMc plot S 914, tropical forest in Lagos de Monte Bello, Chiapas, Mexico, 16.1004, –91.6871); EUK 0649725 (GSMc plot G 5037, tropical forest in Maricao, Puerto Rico, 18.1450, –66.9669); EUK 0137040, EUK 0474865 and EUK 0519433 (all GSMc plot S 381, tropical forest soil in Col Palmarena, Costa Rica, 10.2211, –84.5992); and EUK 0474859 and EUK 0519530 (both GSMc plot JYK 042, tropical forest soil in Barclayville, Liberia, 4.6777°N, 8.1230°E).</p><p>Etymology.</p><p>Tropica (Greek) refers to the tropics, where the genus mainly occurs; Toro Negro (Spanish) refers to the type locality.</p><p>Notes.</p><p>Found in soil in tropical rainforest habitats of Central America and West Africa (six localities). There are no additional GlobalFungi records.</p></div>	https://treatment.plazi.org/id/BC7695C5B463568B95622A35EEAE9C2D	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
3AE386D8257B5AF8A7DA8D20FE40BC6C.text	3AE386D8257B5AF8A7DA8D20FE40BC6C.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Viljandia globalis Tedersoo 2025	<div><p>Viljandia globalis Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Viljandia based on ITS 2 (positions 73–92 ggattgcatggactgccgtc; one mismatch allowed) and LSU (positions 594–613 gcaaagctaccgtgtccaga; one mismatch allowed) as indicated in Fig. 58. Intraspecific variation up to 7.5 % in ITS 2 and up to 2.2 % in LSU. Interspecific distance&gt; 20 % in ITS 2.</p><p>Type.</p><p>Vouchered soil sample TUE 028497 (holotype); eDNA sequence EUK 1124341 = OZ 253815 (legitype); eDNA sample TUE 128497 (nucleotype); GSMc plot G 5902, irrigated stadium lawn in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=25.6068&amp;materialsCitation.latitude=58.3611" title="Search Plazi for locations around (long 25.6068/lat 58.3611)">Viljandi</a>, Estonia, 58.3611°N, 25.6068°E .</p><p>Description.</p><p>Other sequences: EUK 1632579 (GSMc plot G 4506, woodland soil in Terikeste Hiiepärna, Estonia, 58.2972°N, 27.0681°E); LC 204214 ( Picea crassifolia temperate forest soil in Inner Mongolia, China, 38.77°N, 105.89°E); EUK 1124345 (GSMc plot G 5901, Aesculus hippocastanum alley soil in Tartu, Estonia, 58.3676°N, 26.7255°E); EUK 1105441 (boreal coniferous forest soil near Hofors, Sweden, 60.49°N, 16.3°E); EUK 1216896 (GSMc plot G 4796, Acer platanoides forest soil in Alavere, Estonia, 58.7562°N, 26.5109°E); KF 296788 (tundra soil in Prince Patrick Island, Canada, 76.23, – 119.3); and MK 536720 (soil crust in Victoria Land, Antarctica).</p><p>Etymology.</p><p>Viljandi (Estonian) refers to the type locality, and globus (Latin) refers to the globe, reflecting the cosmopolitan distribution.</p><p>Notes.</p><p>Distributed in soil worldwide, including Antarctica (n = 39 records). The 119 additional GlobalFungi records support these findings.</p></div>	https://treatment.plazi.org/id/3AE386D8257B5AF8A7DA8D20FE40BC6C	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
325473CB7AED52A8A79A36AA5398D88B.text	325473CB7AED52A8A79A36AA5398D88B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Viljandia Tedersoo 2025	<div><p>Viljandia Tedersoo gen. nov.</p><p>Type species.</p><p>Viljandia globalis Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other species of Viljandiaceae based on diagnostic nucleotide signatures in SSU V 9 (positions 1695–1709 in S. cerevisiae ggcttccggcagcca; one mismatch allowed) and 5.8S (positions 126–135 in the type species and 126–134 in S. cerevisiae cactctaagg; one mismatch allowed). Forms a monophyletic, least inclusive clade in Viljandiaceae, covering sequences EUK 1105441, EUK 1124341, and EUK 1124345 (Figs 1, 57).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently comprises Viljandia globalis (sp. nov.).</p></div>	https://treatment.plazi.org/id/325473CB7AED52A8A79A36AA5398D88B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
45A0007CDA43544ABFB49B0D76769315.text	45A0007CDA43544ABFB49B0D76769315.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Viljandiaceae Tedersoo 2025	<div><p>Viljandiaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Viljandia Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in SSU V 9 (positions 1695–1709 in S. cerevisiae gccagcaatggcagc; one mismatch allowed). Forms a monophyletic, least inclusive clade in Viljandiales, covering sequences EUK 1105441, EUK 1124341, EUK 1124345, and EUK 0524033 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Includes Viljandia (gen. nov.) and potentially another genus-level taxon represented by the sequence EUK 0524033 (forest soil in India).</p></div>	https://treatment.plazi.org/id/45A0007CDA43544ABFB49B0D76769315	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
96478BBAFDF2500A94425145D82A76FC.text	96478BBAFDF2500A94425145D82A76FC.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Viljandiales Tedersoo 2025	<div><p>Viljandiales Tedersoo ord. nov.</p><p>Type family.</p><p>Viljandiaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 464–478 in type species and 490–504 in S. cerevisiae ctggccaacatcagt, one mismatch allowed). Forms a monophyletic, least inclusive clade in Viljandiomycetes, covering sequences EUK 1699905, EUK 1104555, EUK 1124343, EUK 1124346, EUK 1104962, EUK 1124344, EUK 1202387, EUK 1100361, EUK 1201679, EUK 1105441, EUK 1124341, and EUK 1124345 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Viljandiaceae (fam. nov.) and several potentially family-level taxa represented by sequences EUK 1699905 (forest soil in Ethiopia), EUK 1104555 (forest soil in Sweden), EUK 1124343 (wasteland soil in Estonia), EUK 1124346 (urban soil in Estonia), EUK 1104962 (forest soil in Puerto Rico), EUK 1124344 (urban soil in Estonia), EUK 1202387 (tundra soil in Finland), EUK 1100361 (lake water in Sweden), and EUK 1201679 (forest soil in Sweden).</p></div>	https://treatment.plazi.org/id/96478BBAFDF2500A94425145D82A76FC	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
DC6147AF12A751DAB9358A4435A43014.text	DC6147AF12A751DAB9358A4435A43014.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Viljandiomycetes Tedersoo	<div><p>Viljandiomycetes Tedersoo class. nov.</p><p>Type order.</p><p>Viljandiales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in LSU D 2 (positions 464–478 in type species and 490–504 in S. cerevisiae ctggccaacatcagt, one mismatch allowed). Forms a monophyletic, least inclusive clade in Viljandiomycota, covering sequences EUK 1699905, EUK 1104555, EUK 1124343, EUK 1124346, EUK 1104962, EUK 1124344, EUK 1202387, EUK 1100361, EUK 1201679, EUK 1105441, EUK 1124341, and EUK 1124345 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently harbors Viljandiales (ord. nov.).</p></div>	https://treatment.plazi.org/id/DC6147AF12A751DAB9358A4435A43014	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
300045A0CCFA5CA59F9B6FBA33BF5541.text	300045A0CCFA5CA59F9B6FBA33BF5541.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Viljandiomycota Tedersoo 2025	<div><p>Viljandiomycota Tedersoo phyl. nov.</p><p>Type class.</p><p>Viljandiomycetes Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 2 (positions 464–478 in type species and 490–504 in S. cerevisiae ctggccaacatcagt; one mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 1699905, EUK 1104555, EUK 1124343, EUK 1124346, EUK 1104962, EUK 1124344, EUK 1202387, EUK 1100361, EUK 1201679, EUK 1105441, EUK 1124341, and EUK 1124345 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Encoded as clade GS 40 in EUKARYOME v 1.9. Currently harbors Viljandiomycetes (class. nov.). Comprises 60–90 potential species. Detected in soil (98.2 % out of 265 records), freshwater (0.7 %), sediments (0.4 %), and plant roots (0.4 %) in high arctic to wet tropical biomes across all continents, including Antarctica.</p></div>	https://treatment.plazi.org/id/300045A0CCFA5CA59F9B6FBA33BF5541	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
ED3F60193F2E59F3B8707B96AAA54785.text	ED3F60193F2E59F3B8707B96AAA54785.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Waitukubulimyces cliftonii Tedersoo 2025	<div><p>Waitukubulimyces cliftonii Tedersoo sp. nov.</p><p>Diagnosis.</p><p>Separation from other species of Waitukubulimyces based on ITS 1 (positions 59–78 actgtgaaattgctctggta; one mismatch allowed) and LSU (positions 470–489 tttttgtttgatgagtagag; one mismatch allowed) as indicated in Fig. 60. Intraspecific variation up to 5.3 % in ITS 1. Interspecific distance&gt; 20 % in ITS 1.</p><p>Type.</p><p>Vouchered soil sample TUE 002020 (holotype); eDNA sequence EUK 1186291 = OZ 253816 (legitype); eDNA sample TUE 102020 (nucleotype); GSMc plot G 5043, tropical rainforest in <a href="https://tb.plazi.org/GgServer/search?materialsCitation.longitude=-61.3428&amp;materialsCitation.latitude=15.2567" title="Search Plazi for locations around (long -61.3428/lat 15.2567)">Bellevue Chopin</a>, Dominica, 15.2567, –61.3428 °E .</p><p>Description.</p><p>Other sequences: MK 718926 and MK 718947 (both: barren soil in CO, USA); GlobalFungi records 3 c 686302 c 6 bfd 00 ff 4 db 5 b 414 d 28 c 645 ( woodland soil in Marina, CA, USA, 36.6849, – 121.7780°E); 4 d 070 bd 97 b 6 d 68091 a 85749 c 15 e 6 c 744 (forest soil in Soria, Spain, 41.8694, – 2.87528°E); 61 c 43 b 4 d 22 e 1 a 0 efa 38 d 2 dba 3311970 e (cropland soil in Hangle, Uyghuria, China, 46.1886°N, 83.3294°E); 90 b 3386 fc 8 d 47 acc 87 e 18126 f 1 c 5 e 50 b (near-glacier soil in Arikaree, CO, USA); and abb 8924 cf 48 b 17 d 892 b 88816 e 96 f 0 ff 0 (grassland soil in Yahelong Gongma, Tibet, 38.21°N, 98.16°E).</p><p>Etymology.</p><p>&gt; Waitukubuli&gt; (Igneri) refers to the country of Dominica, where the type material was collected, and Clifton refers to Clifton P. Bueno de Mesquita, who collected the first material of this species (MK 718926 and MK 718947; Bueno de Mesquita et al. 2020).</p><p>Notes.</p><p>Recorded from soil in three localities in Dominica and the USA. The 11 additional GlobalFungi records supplement findings from soil in various habitats in Spain, China, Tunisia, and the USA. ITS 1 was used in molecular diagnosis instead of ITS 2 because only a single sequence was available for ITS 2.</p></div>	https://treatment.plazi.org/id/ED3F60193F2E59F3B8707B96AAA54785	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
AECA181964F2519BA850C302EA439ED4.text	AECA181964F2519BA850C302EA439ED4.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Waitukubulimyces Tedersoo 2025	<div><p>Waitukubulimyces Tedersoo gen. nov.</p><p>Type species.</p><p>Waitukubulimyces cliftonii Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU 5 ’ end (positions 52–66 in type species and S. cerevisiae tggaggaaaagaaaa, no mismatch allowed), LSU D 2 (positions 246–262 in type species and 240–256 in S. cerevisiae tgtgttcrctctgtgat; one mismatch allowed), and ITS 2 (positions 129–138 in type species tgggtcactt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Waitukubulimycetaceae, covering sequences EUK 1120710, EUK 1173015, EUK 1186290, EUK 1186291, and EUK 1186292 (Figs 1, 59).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Comprises five potential species represented by sequences EUK 1120710 (botanical garden soil in Estonia), EUK 1173015 (forest soil in China), and EUK 1186290 and EUK 1186292 (both forest soil in Puerto Rico).</p></div>	https://treatment.plazi.org/id/AECA181964F2519BA850C302EA439ED4	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
4D06A5841D525AA292C715D77204B61B.text	4D06A5841D525AA292C715D77204B61B.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Waitukubulimycetaceae Tedersoo 2025	<div><p>Waitukubulimycetaceae Tedersoo fam. nov.</p><p>Type genus.</p><p>Waitukubulimyces Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU 5 ’ end (positions 52–66 in type species and S. cerevisiae tggaggaaaagaaaa, no mismatch allowed) and LSU D 2 (positions 246–262 in type species and 240–256 in S. cerevisiae tgtgttcrctctgtgat; one mismatch allowed) and ITS 2 (positions 129–138 in type species tgggtcactt; one mismatch allowed). Forms a monophyletic, least inclusive clade in Waitukubulimycetales, covering sequences EUK 1120710, EUK 1173015, EUK 1186290, EUK 1186291, and EUK 1186292 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently comprises Waitukubulimyces (gen. nov.).</p></div>	https://treatment.plazi.org/id/4D06A5841D525AA292C715D77204B61B	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
761C2DF9552959EBB171F2092D1BCEC5.text	761C2DF9552959EBB171F2092D1BCEC5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Waitukubulimycetales Tedersoo 2025	<div><p>Waitukubulimycetales Tedersoo ord. nov.</p><p>Type family.</p><p>Waitukubulimycetaceae Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU 5 ’ end (positions 52–66 in type species and S. cerevisiae tggaggaaaagaaaa, no mismatch allowed) and LSU D 2 (positions 246–262 in type species and 240–256 in S. cerevisiae tgtgttcrctctgtgat; two mismatches allowed). Forms a monophyletic, least inclusive clade in Waitukubulimycetes, covering sequences EUK 1120710, EUK 1173015, EUK 1186290, EUK 1186291, and EUK 1186292.</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Currently includes Waitukubulimycetaceae (fam. nov.).</p></div>	https://treatment.plazi.org/id/761C2DF9552959EBB171F2092D1BCEC5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
C07D24BE95A351658B782A71BAFC7686.text	C07D24BE95A351658B782A71BAFC7686.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Waitukubulimycetes Tedersoo	<div><p>Waitukubulimycetes Tedersoo class. nov.</p><p>Type order.</p><p>Viljandiales Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in the LSU 5 ’ end (positions 52–66 in the type species and S. cerevisiae tggaggaaaagaaaa, no mismatch allowed). Forms a monophyletic, least inclusive clade in Waitukubulimycota, covering sequences EUK 1120710, EUK 1173015, EUK 1186290, EUK 1186291, and EUK 1186292 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Waitukubulimycetes currently harbors Waitukubulimycetales.</p></div>	https://treatment.plazi.org/id/C07D24BE95A351658B782A71BAFC7686	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
95333BF59D23564A84851B74ED5E7593.text	95333BF59D23564A84851B74ED5E7593.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Tartumyceta Tedersoo & Hosseyni Moghadam & Panksep & Prins & Anslan & Mikryukov & Bahram & Abarenkov & Kõljalg & Esmaeilzadeh-Salestani & Pawłowska & Wurzbacher & Ding & Alkahtani & Nilsson 2025	<div><p>Tartumyceta Tedersoo subreg. nov.</p><p>Type phylum.</p><p>Tartumycota Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on diagnostic nucleotide signatures in LSU D 3 (positions 1009–1023 in type species and 969–983 in S. cerevisiae ggaacttgtacagtt, no mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences OQ 702815, EUK 1186161, OQ 687331, EUK 1186165, EUK 1186157, EUK 1200073, EUK 1186162, EUK 1123648, EUK 1138300, OQ 702816, ON 754309, UDB 028835, and HQ 191300 (Fig. 1).</p><p>Notes.</p><p>Recognized as a subkingdom due to its sister position to all remaining fungi. Currently harbors Tartumycota (phyl. nov.).</p></div>	https://treatment.plazi.org/id/95333BF59D23564A84851B74ED5E7593	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
A5ABFD10E4C25B09BE9E7F45767127DB.text	A5ABFD10E4C25B09BE9E7F45767127DB.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Waitukubulimycota Tedersoo 2025	<div><p>Waitukubulimycota Tedersoo phyl. nov.</p><p>Type class.</p><p>Waitukubulimycetes Tedersoo .</p><p>Diagnosis.</p><p>Distinguishable from other fungi based on a diagnostic nucleotide signature in the LSU 5 ’ end (positions 52–66 in the type species and S. cerevisiae tggaggaaaagaaaa, no mismatch allowed). Forms a monophyletic, least inclusive clade in fungi, covering sequences EUK 1120710, EUK 1173015, EUK 1186290, EUK 1186291, and EUK 1186292 (Fig. 1).</p><p>Notes.</p><p>Recognized based on eDNA sequences only. Not encoded specifically in EUKARYOME v 1.9. Waitukubulimycota currently harbors the single class Waitukubulimycetes . Waitukubulimycota comprises five species. Members of this phylum have been detected in soil (100 % out of seven records) in arctic to wet tropical biomes across all continents, excluding Antarctica.</p></div>	https://treatment.plazi.org/id/A5ABFD10E4C25B09BE9E7F45767127DB	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
F7FBB75A57BB5A809C793A066ED67037.text	F7FBB75A57BB5A809C793A066ED67037.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Zoopagomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg & Abarenkov	<div><p>Zoopagomyceta Tedersoo, Sanchez-Ramirez, Kõljalg, Bahram, M. Döring, Schigel, T. W. May, M. Ryberg &amp; Abarenkov, Fungal Diversity 90: 150 (2018)</p><p>Type phylum.</p><p>Zoopagomycota Gryganskyi, M. E. Smith, Spatafora &amp; Stajich, Mycologia 108 (5): 1035 (2016) [816300].</p><p>Description.</p><p>As in Tedersoo et al. (2018)</p><p>Notes.</p><p>Currently harbors Entomophthoromycota, Kickxellomycota, Zoopagomycota, Aldinomycota (phyl. nov.), Borikeniomycota (phyl. nov.), Mirabilomycota (phyl. nov.), Nematovomycota (phyl. nov.), Viljandiomycota (phyl. nov.), and Waitukubulimycota (phyl. nov.).</p></div>	https://treatment.plazi.org/id/F7FBB75A57BB5A809C793A066ED67037	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Pensoft via Plazi	Tedersoo, Leho;Hosseyni Moghadam, Mahdieh S.;Panksep, Kristel;Prins, Victoria;Anslan, Sten;Mikryukov, Vladimir;Bahram, Mohammad;Abarenkov, Kessy;Kõljalg, Urmas;Esmaeilzadeh-Salestani, Keyvan;Pawłowska, Julia;Wurzbacher, Christian;Ding, Yi;Alkahtani, Saad Hussin;Nilsson, R. Henrik	Tedersoo, Leho, Hosseyni Moghadam, Mahdieh S., Panksep, Kristel, Prins, Victoria, Anslan, Sten, Mikryukov, Vladimir, Bahram, Mohammad, Abarenkov, Kessy, Kõljalg, Urmas, Esmaeilzadeh-Salestani, Keyvan, Pawłowska, Julia, Wurzbacher, Christian, Ding, Yi, Alkahtani, Saad Hussin, Nilsson, R. Henrik (2025): Thirty novel fungal lineages: formal description based on environmental samples and DNA. MycoKeys 124: 1-121, DOI: 10.3897/mycokeys.124.161674
