identifier	taxonID	type	CVterm	format	language	title	description	additionalInformationURL	UsageTerms	rights	Owner	contributor	creator	bibliographicCitation
BC4C186D9A51B77AFF17FE3C469ECA3F.text	BC4C186D9A51B77AFF17FE3C469ECA3F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dna extraction	<div><p>Sampling, extraction and morphological identification of nematodes</p><p>Several moss samples were collected from a few habitats and localities of Siahkal forests, located in Gilan province, northern Iran. The samples were cut into smaller pieces for nematode extraction. Nematodes were extracted using the tray method (Whitehead and Hemming 1965), handpicked under a stereomicroscope, killed by adding hot FPG (4:1:1 formaldehyde: propionic acid:glycerine) solution, transferred to anhydrous glycerine according to De Grisse (1969), and mounted on permanent glass slides to be observed under light microscopy.</p><p>Specimens were examined using a Nikon Eclipse 80i light microscope provided with differential interference contrast (DIC) optics, a Nikon Digital Sight DS-U1 camera and a drawing tube . Raw photographs were edited using Adobe ® Photoshop ® CS . Morphometrics include Demanian indices and other measurements and ratios; the most relevant of them are presented in a separate table, while others appear to form part of the literal description of the species. The female holotype and paratypes are deposited in the Nematode Collections of Universidad de Jaén, Spain, and University of Zanjan, Iran . Please refer to the ‘Type material’ section for more details.</p></div>	https://treatment.plazi.org/id/BC4C186D9A51B77AFF17FE3C469ECA3F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Asgari, Mohsen;Mokhtari, Somayeh;Eskandari, Ali;Peña-Santiago, Reyes	Asgari, Mohsen, Mokhtari, Somayeh, Eskandari, Ali, Peña-Santiago, Reyes (2025): Description and molecular characterisation of Aquatides caelibis sp. n. (Dorylaimida: Nygolaimidae) from Iran, with updated taxonomy of the genus and new insights into its evolutionary relationships. Journal of Natural History 59 (25 - 28): 1877-1893, DOI: 10.1080/00222933.2025.2501394, URL: https://doi.org/10.1080/00222933.2025.2501394
BC4C186D9A51B779FF17FB8545E7CF0F.text	BC4C186D9A51B779FF17FB8545E7CF0F.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Dna extraction PCR	<div><p>DNA extraction, PCR and sequencing</p><p>Following morphological confirmation, some fresh individuals were selected for DNA extraction . DNA was extracted using the modified Chelex method (Rashidifard et al. 2019). Each nematode was transferred to an Eppendorf tube containing 20 μL of nuclease-free water, 25 μL Chelex (5%, w/v) and 5 μL of proteinase K (20 mg /mL). The microtubes were incubated at 56°C for 2 h, then at 95°C for 10 min, and the solutions obtained were used as DNA templates. Next, 5 μL of each extracted DNA was added to the polymerase chain reaction (PCR) mixture in a 0.2 mL Eppendorf tube containing:15 μL 2X Master mix (Ampliqon, Odense, Denmark), 1 μL of each primer (10 pmol/μL) and 8 μL ddH 2 O, to a final volume of 30 μL. The D2–D3 region of 28S rDNA (LSU) were amplified using forward D2A (5’– ACAAGTACCGTGAGGGAAAGTTG–3’) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3’) primers (Nunn 1992; De Ley et al. 1999). PCR reactions were carried out in a DNA thermal cycler (Hybaid, Ashford, Middlesex, UK). The PCR cycle conditions were as follows: initial denaturation cycle at 94°C for 15 min, followed by 35 cycles of denaturation at 94°C for 45s; an annealing cycle at 56°C for 45s; an extension cycle at 72°C for 1 min; and finally an elongation cycle at 72°C for 5 min. After DNA amplification, the quality of PCR was checked by electrophoresis of 4 μL of the PCR reactions in 1% agarose gel containing SYBR Green I. Products were visualised and photographed under ultraviolet light. The length and concentration of each PCR product were measured by comparison with a low DNA mass ladder (Invitrogen, Carlsbad, CA). The PCR products were purified and sequenced directly for both strands using the same primers with an ABI 3730XL sequencer (Bioneer, Seoul, South Korea). The newly obtained sequences of the D2–D3 region of 28S rDNA were submitted to the GenBank database.</p></div>	https://treatment.plazi.org/id/BC4C186D9A51B779FF17FB8545E7CF0F	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Asgari, Mohsen;Mokhtari, Somayeh;Eskandari, Ali;Peña-Santiago, Reyes	Asgari, Mohsen, Mokhtari, Somayeh, Eskandari, Ali, Peña-Santiago, Reyes (2025): Description and molecular characterisation of Aquatides caelibis sp. n. (Dorylaimida: Nygolaimidae) from Iran, with updated taxonomy of the genus and new insights into its evolutionary relationships. Journal of Natural History 59 (25 - 28): 1877-1893, DOI: 10.1080/00222933.2025.2501394, URL: https://doi.org/10.1080/00222933.2025.2501394
BC4C186D9A52B779FEE1FAAD475ACBA5.text	BC4C186D9A52B779FEE1FAAD475ACBA5.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Aquatides caelibis Asgari and Pena-Santiago 2025	<div><p>Aquatides caelibis Asgari and Peña-Santiago sp. n.</p><p>(Figures 1 and 2, Table 1)</p></div>	https://treatment.plazi.org/id/BC4C186D9A52B779FEE1FAAD475ACBA5	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Asgari, Mohsen;Mokhtari, Somayeh;Eskandari, Ali;Peña-Santiago, Reyes	Asgari, Mohsen, Mokhtari, Somayeh, Eskandari, Ali, Peña-Santiago, Reyes (2025): Description and molecular characterisation of Aquatides caelibis sp. n. (Dorylaimida: Nygolaimidae) from Iran, with updated taxonomy of the genus and new insights into its evolutionary relationships. Journal of Natural History 59 (25 - 28): 1877-1893, DOI: 10.1080/00222933.2025.2501394, URL: https://doi.org/10.1080/00222933.2025.2501394
BC4C186D9A57B773FF1DFCE5459BCA70.text	BC4C186D9A57B773FF1DFCE5459BCA70.taxon	http://purl.org/dc/dcmitype/Text	http://rs.tdwg.org/ontology/voc/SPMInfoItems#GeneralDescription	text/html	en	Nygolaimus (Aquatides) Heyns 1968	<div><p>Nygolaimus (Aquatides) Heyns, pp. 35–43.</p><p>Diagnosis</p><p>Nygolaimidae, Nygolaiminae . Small- to large-sized nematodes, 0.7–3.7 mm long. Cuticle dorylaimoid. Lip region continuous with the adjoining body (but very exceptionally offset), often asymmetrical, truncate or somewhat cap-like, with fused lips and low papillae. Amphid fovea cup-like, its aperture barely less than one-half of the lip region diameter. Mural tooth linear, about as long as lip region diameter. Guiding ring weak, plicate. Pharynx entirely muscular, enlarging gradually, the basal expansion surrounded by a weak but perceptible sheath and often occupying more than half (up to three-fifths) of neck length. Cardiac cells conspicuous, rounded to ovoid. Female genital system diovarian, with simple uterus, absence of pars refringens vaginae and transverse vulva. Tail similar in both sexes, convexconoid to nearly hemispheroid. Most species bisexual. Spicules dorylaimid. Gubernaculum present. Ventromedian supplements 2–7 in number, irregularly spaced, with hiatus.</p><p>Etymology</p><p>The genus name derives from that of its type species, A. aquaticus .</p><p>Type species</p><p>A. aquaticus (Thorne, 1930) Heyns 1968</p><p>= Nygolaimus aquaticus Thorne, 1930</p><p>= Nygolaimus (Aquatides) aquaticus Thorne, 1930 (Heyns 1968)</p><p>Other species: A. caelibis sp. n. A. christiei Heyns, 1968</p><p>= Nygolaimus (Aquatides) aquaticus Heyns</p><p>A. christicki Ahmad and Jairajpuri</p><p>A. coboi De Ley and Coomans</p><p>A. deconincki Jairajpuri and Coomans</p><p>A. heynsi Gusakov and Gagarin</p><p>A. ibericus Jiménez-Guirado, Castro-Alhama and Murillo-Navarro A. intermedius (de Man) Heyns</p><p>= Dorylaimus intermedius de Man</p><p>= Eudorylaimus intermedius (de Man) Andrássy</p><p>= Nygolaimus intermedius (de Man) Loof</p><p>= Nygolaimus (Aquatides) intermedius de Man (Heyns) A. minutus Dhanam, Jairajpuri and Sredharam</p><p>A. shadini (Filipjev) Heyns</p><p>= Nygolaimus shadini Filipjev</p><p>= Nygolaimus (Aquatides) shadini Filipjev; (Heyns)</p><p>A. smoliki Thorne</p><p>A. thornei (Schneider) Heyns</p><p>= Nygolaimus thornei Schneider</p><p>= Nygolaimus (Aquatides) thornei Schneider (Heyns)</p><p>Species incertae sedis:</p><p>A. frigidus (Steiner) Andrássy</p><p>= Dorylaimus frigidus Steiner</p><p>= Eudorylaimus frigidus (Steiner) Andrássy</p><p>A. kaburakii (Imamura) Heyns</p><p>= Nygolaimus kaburakii Imamura</p><p>= Nygolaimus (Aquatides) kaburakii Imamura (Heyns) A. rotundicaudatus Thorne</p></div>	https://treatment.plazi.org/id/BC4C186D9A57B773FF1DFCE5459BCA70	Public Domain	No known copyright restrictions apply. See Agosti, D., Egloff, W., 2009. Taxonomic information exchange and copyright: the Plazi approach. BMC Research Notes 2009, 2:53 for further explanation.		Plazi	Asgari, Mohsen;Mokhtari, Somayeh;Eskandari, Ali;Peña-Santiago, Reyes	Asgari, Mohsen, Mokhtari, Somayeh, Eskandari, Ali, Peña-Santiago, Reyes (2025): Description and molecular characterisation of Aquatides caelibis sp. n. (Dorylaimida: Nygolaimidae) from Iran, with updated taxonomy of the genus and new insights into its evolutionary relationships. Journal of Natural History 59 (25 - 28): 1877-1893, DOI: 10.1080/00222933.2025.2501394, URL: https://doi.org/10.1080/00222933.2025.2501394
