taxonID	type	description	language	source
E87A9B1F9A7D8504FE2D29B06770918D.taxon	description	(Figs. 1 part, 2 – 3)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7D8504FE2D29B06770918D.taxon	diagnosis	Definition and diagnosis. Genomic phylogeny of Catocyclotis Stichel, 1911 (type species Hesperia aemulius Fabricius, 1793) reveals that specimens identified as Catocyclotis sejuncta (Stichel, 1910) (type locality in Brazil: Rio de Janeiro) are genetically differentiated from its lectotype (sequenced as NVG- 21121 A 10) at the species level (Fig. 1), e. g., the COI barcode of a specimen from Peru differs by 3.0 % (20 bp). Therefore, this specimen represents a new species. This new species is similar to C. sejuncta and differs from it by paler ventral forewing with more developed pearly overscaling with brown scales partly replaced with pearly scales over the entire ventral surface. According to Hall (2018), who treated it as a color variant of C. sejuncta not differing in genitalia, which are shown in Fig. 3 and appear to have a shorter and more stout harpe that is more gradually bent inwards compared to C. sejuncta. Due to the cryptic nature of this species, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 5853.1.9: G 39 A, cne 403.6.1: C 289 T, cne 2935. 2.13: G 72 T, cne 9494.2.1: C 33 T, cne 6332.2.1: G 192 A, cne 2307.5.2: C 98 C (not T), cne 2307.5.2: G 109 G (not A), cne 1302.6.1: C 487 C (not T), cne 364.20.1: G 150 G (not A), cne 5120.2.1: C 142 C (not A), and COI barcode: T 1 C, G 38 A, A 122 G, G 218 A, A 346 C, G 389 A. Barcode sequence of the holotype. Sample NVG- 18048 E 06, GenBank PQ 489696, 658 base pairs: CACATTATATTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCTTTAAGTCTTTTAATTCGTATAGAATTAGGAACTCCCGGATCATTAATTGGAGATGATCAAATTTATAATACT GTTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAATTCCTTTAATATTAGGTACTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGATTATTACCCCCTTCATTATTTCTTTTAATTTCAAGAAAAATTGTAGAAAATGGTACAGGAACTGGATGAACAATTTACCCCCCCCTATCATCTAATATTGC CCATGGAGGAGCATCAGTTGATTTAACTATTTTTTCTCTTCATTTAGCTGGTATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGTATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACTGCATTATTATTATTATTATCTTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7D8504FE2D29B06770918D.taxon	distribution	Distribution. Currently known only from the holotype collected in Cuzco, Peru. http: // zoobank. org / 5 C 003 A 6 B- 7805 - 4 B 04 - B 91 C-C 8943558 CFBE (Figs. 1 part, 4)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7D8504FE2D29B06770918D.taxon	diagnosis	Definition and diagnosis. Genomic phylogeny of Catocyclotis Stichel, 1911 (type species Hesperia aemulius Fabricius, 1793) reveals that specimens identified as Catocyclotis sejuncta (Stichel, 1910) (type locality in Brazil: Rio de Janeiro) are genetically differentiated from its lectotype (sequenced as NVG- 21121 A 10) at the species level (Fig. 1), e. g., the COI barcode of a specimen from Rio de Janeiro differs by 3.2 % (21 bp). Therefore, this specimen represents a new species. This new species is similar to C. sejuncta and differs from it by darker ventral hindwing with less developed pearly overscaling and some purple overscaling on the dorsal hindwing. According to Hall (2018), who treated it as a color variant of C. sejuncta and detailed the differences between them, it does not differ from it in genitalia, thus best identified by its darker phenotype. Due to the cryptic nature of this species, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: cne 3539.9.2: T 108 C, cne 3539.9.2: A 120 C, cne 16860.2.5: A 927 G, cne 1023.1.1: G 87 A, cne 14049.3.4: C 58 T, cne 682.1.3: T 114 T (not C), cne 5853.1.9: G 39 G (not A), cne 20858.1.2: C 456 C (not A), cne 20858.1.2: T 465 T (not C), cne 20858.1.2: A 1371 A (not G), and COI barcode: T 34 C, C 85 T, T 106 C, A 160 G, T 259 C, T 547 C. Barcode sequence of the holotype. Sample NVG- 19032 G 06, GenBank PQ 489697, 658 base pairs: TACATTATATTTTATTTTTGGAATTTGAGCAGGCATAGTAGGAACATCTTTAAGTCTTTTAATTCGTATAGAATTAGGAACTCCTGGATCATTAATTGGTGATGACCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATGGTTATACCTATTATAATTGGAGGTTTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCATTTCCACGAA TAAATAATATAAGATTCTGATTACTACCCCCTTCATTATTTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCACTATCATCTAATATTGC CCATGGAGGATCATCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCCTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAACATACGTATTAATAATTTATCT TTTGATCAAATACCTTTATTTGTTTGATCTGTAGGAATTACTGCATTATTGTTATTATTATCCTTACCTGTATTAGCAGGTGCTATTACTATATTATTAACAGATCGAAATTTAAATACAT CATTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7D8504FE2D29B06770918D.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Washington, DC, USA (USNM), illustrated in Fig. 4, bears five printed (text in italics handwritten) labels: four white [BRAZIL, RJ, Teresopolis | 22 ° 27 ' S, 42 ° 59 ' W | 17 Dec 1996 1,000 m | Leg. Robbins & Caldas], [Genitalia vial | Catocyclotis | sejuncta | USNM 344 | J. P. W. Hall], [DNA sample ID: | NVG- 19032 G 06 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01544522], and one red [HOLOTYPE ♂ | Catocyclotis | serio Grishin]. Type locality. Brazil: Rio de Janeiro, Teresópolis, elevation 1000 m, GPS − 22.450, − 42.983.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7D8504FE2D29B06770918D.taxon	etymology	Etymology. The name sejuncta likely comes from the Latin verb sejungere, which means to set apart, separate, or divide. Therefore, sejuncta can be interpreted to mean separated, set apart, divided, isolated, or secluded. We are dividing this species into several, and a segregate from Rio gets its name as se [gregate] + Rio. The name is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7D8504FE2D29B06770918D.taxon	distribution	Distribution. Currently known only from the holotype collected in Rio de Janeiro, Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7F850AFE172EB166C597A6.taxon	description	(Figs. 1 part, 5) Definition and diagnosis. Genomic phylogeny of Catocyclotis Stichel, 1911 (type species Hesperia aemulius Fabricius, 1793) reveals that a specimen from Bolivia curated in MFNB as a type of Echenais	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7F850AFE172EB166C597A6.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 5, bears seven labels (3 rd handwritten, others printed with handwritten text in shown italics; 1 st and the last red, others white): [Type], [Rio Songo (1200 m) | Bolivia (Yungas) | 189 6 — 6 Garlepp], [luteonaevia | Stich.], [Coll. | Staudinger], [DNA sample ID: | NVG- 21121 A 12 | c / o Nick V. Grishin], [ex coll. | H. STICHEL], and [HOLOTYPE ♀ | Catocyclotis | luteonaevia Grishin]. The holotype is missing its abdomen. Type locality. Bolivia: La Paz Department, Río Zongo, elevation 1200 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7F850AFE172EB166C597A6.taxon	etymology	Etymology. For the stability of nomenclature, the infrasubspecific name proposed by Stichel (1911) is name is given for the yellowish (actually, orange-brown) outer margin of the dorsal hindwing and is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A7F850AFE172EB166C597A6.taxon	distribution	Distribution. Currently known only from the holotype collected in western Bolivia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A71850AFDCC2973670590FA.taxon	diagnosis	Definition and diagnosis. Genomic analysis of additional specimens in the Synargis regulus group reveals a clade from Brazil (Bahia and Goiás) (Fig. 6 red) representing a taxon most closely related to Synargis regina Grishin, 2024 (type locality in Peru) (Fig. 6 blue) and Synargis reginella Grishin, 2024 (type locality in Brazil: Pará) (Fig. 6 green), but distinct from them both at the species level (Fig. 6), e. g., its COI barcodes differ from those of S. regina and S. reginella by 2 % (13 bp) and 2.4 % (16 bp), respectively. This new species is most similar to S. regina and S. reginella and differs by less extensive than in S. reginella but more extensive than in S. regina yellow spotting along the outer margin of ventral hindwing, somewhat broader brown bands between yellow areas, and longer than in S. reginella postdiscal yellow area along the inner margin of hindwing as a result of wider separation between the brown bands towards the inner margin. Males are yellower and less orange than S. reginella, with abdomen brown above and pale-yellow beneath (males of S. regina are unknown). Females of the new species we sequenced are smaller in size than either S. regina or S. reginella (Fig. 7). However, the male is comparable to males of S. reginella, and, therefore, the difference in size may be individual variation. Due to unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: cne 6558.13.3: A 1623 C, cne 6558.13.3: C 1632 T, cne 12987.3.24: G 2562 T, cne 12987.3.24: T 2565 G, cne 12987.3.24: T 2568 G, and COI barcode: C 81 C, T 274 T, T 283 C, T 334 T, T 479 C, T 514 C. Barcode sequence of the holotype. Sample NVG- 23103 C 07, GenBank PQ 489699, 658 base pairs: AACTTTATATTTTATTTTTGGAATCTGAGCAGGTATAATAGGAACATCTCTTAGTTTATTAATTCGAATAGAATTAGGAACTCCTGGTTCTTTAATTGGAAATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTTCCTCGTA TAAATAATATAAGATTTTGATTATTACCTCCTTCTTTATTCTTATTAATTTCTAGAAGAATTATTGAAAATGGAGCAGGAACTGGATGAACTGTGTACCCCCCACTTTCATCTAATATTGC TCACAGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATTTTAGGTGCAATTAATTTTATTACTACTATTATTAATATACGTATTAATAATCTATCA TTTGATCAAATACCTTTATTTATTTGATCCGTAGGAATTACTGCTCTTCTTCTTTTATTATCTTTACCTGTTTTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATTTAAATACAT CTTTTTTTGATCCCGCAGGAGGTGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A71850AFDCC2973670590FA.taxon	materials_examined	Type material. Holotype: ♀ currently deposited in the Senckenberg Naturmuseum, Frankfurt, Germany (SMF), illustrated in Fig. 7 e, bears the following three printed rectangular labels, two white: [Rio Preto | März 1927 | Dr. Seitz leg.], [DNA sample ID: | NVG- 23103 C 07 | c / o Nick V. Grishin], and one red [HOLOTYPE ♀ | Synargis | gohia Grishin]. Paratypes: 1 ♂ and 1 ♀ from Brazil in SMF: 1 ♂ NVG- 23103 C 08 Goias, Viannepolla, Nov- 1921, Coll. R. Spitz and 1 ♀ NVG- 23103 C 09 data as the holotype. Type locality. Brazil: Bahia, Preto River.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A71850AFDCC2973670590FA.taxon	etymology	Etymology. The name is a fusion of the names of states where this species has been recorded from: Go [iás] + [Ba] hia. Furthermore, goia means joy in Guaraní, fitting the appearance of this joyful species. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A71850AFDCC2973670590FA.taxon	distribution	Distribution. Currently known from central and northeastern Brazil, the states of Goiás and Bahia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A738508FE2528CE67B59024.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that a specimen from northern Peru unique in its wing pattern (Fig. 9 a) belongs to the Synargis regulus group but is genetically differentiated from others at the species level (Fig. 8), e. g., its COI barcode differs from closer relatives such as Synargis latidifa Grishin, 2024 (type locality in French Guiana) and Synargis tenebritorna Grishin, 2024 (type locality in Brazil: Bahia) by 2.6 % (17 bp), and, therefore, represents a new species. This new species is somewhat intermediate in appearance between typical S. regulus group representatives and Synargis chaonia (Hewitson, [1853]) (type locality in Brazil: Amazonas), and differs from its relatives by much broader (more than 5 times) discal yellow band compared to the submarginal band, mostly due to the submarginal band being narrower than in other species, and by slightly paler yellow color compared to S. latidifa. The new species is also similar to Synargis sylvarum (H. Bates, 1867) (type locality in Brazil: Pará), which we have not sequenced. However, in S. sylvarum, the two submarginal spots are connected into a band on the ventral forewing (separated in the new species), dorsal hindwing submarginal band is longer, nearly reaching costal and inner margins (widely separated from the costal margin in the new species), veins on the ventral side of wings are yellower (of the same brown ground color in the new species), and the forewing central spot-like band narrows anteriad, more triangular in shape (rectangular to oval in the new species). This new species is not cryptic and is recognizable by its wing pattern. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: cne 14967.2.1: C 384 A, cne 14967.2.1: C 387 T, cne 14967.2.1: A 396 G, cne 14967.2.1: C 399 T, cne 14967.2.1: C 405 T, cne 349.3.6: C 84 C (not T), cne 349.3.6: C 90 C (not T), cne 349.3.6: G 117 G (not C), cne 40.6.1: T 711 T (not G), cne 40.6.1: G 717 G (not T), and COI barcode: A 316 T, C 391 C, T 442 C, T 463 C, A 494 T, T 464 C. Barcode sequence of the holotype. Sample NVG- 23103 C 10, GenBank PQ 489700, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAATAGGAACATCTCTTAGTTTACTAATTCGAATAGAATTAGGAACTCCTGAATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCAGATATAGCTTTCCCCCGTA TAAATAACATAAGATTTTGATTATTACCTCCTTCTTTATTTTTATTAATCTCCAGAAGAATTGTTGAAAATGGTGCAGGAACTGGATGAACAGTGTACCCCCCACTTTCATCTAATATTGC TCATAGAGGAACTTCTGTTGATTTAGCCATTTTTTCTCTTCATTTAGCTGGAATTTCATCAATCTTAGGTGCAATTAACTTTATTACTACTATTATTAACATACGTATTAATAATTTATCA TTTGATCAATTACCTTTATTTGTTTGATCAGTAGGAATTACTGCTCTTCTTCTTTTATTATCATTACCTGTTTTAGCGGGAGCTATTACTATATTACTTACTGATCGAAATTTAAATACAT CTTTTTTTGATCCTGCAGGAGGTGGAGATCCAATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A738508FE2528CE67B59024.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the Senckenberg Naturmuseum, Frankfurt, Germany (SMF), illustrated in Fig. 9 a, bears the following three rectangular labels (1 st handwritten, others printed), two white: [Pumayacú | Sept · 1933], [DNA sample ID: | NVG- 23103 C 10 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Synargis | maxidifa Grishin]. Type locality. Peru: Loreto Region, Pumayacu.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A738508FE2528CE67B59024.taxon	etymology	Etymology. The name is given for the large difference in widths of the discal (very broad) and submarginal (narrow) bands, compared to its relative S. latidifa, where the difference is notable: maxi [ma] + dif [ferenti] a, i. e., maximal difference in Latin. The name is treated as an adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A738508FE2528CE67B59024.taxon	distribution	Distribution. Currently known only from the holotype collected in the Loreto Region, northeastern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A72850FFE7A2D85612A9504.taxon	description	(Figs. 8 part, 10 a, 11)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A72850FFE7A2D85612A9504.taxon	diagnosis	Definition and diagnosis. A male from Guyana that is sister to other Synargis flavicauda Grishin, 2024 (type locality Peru: Rio Pachitea, Monte Alegre) shows moderate genetic differentiation from the Peruvian specimens (Fig. 8), e. g., their COI barcodes differ by 1.5 % (10 bp), and therefore represents a new taxon. We conservatively regard it as a subspecies of S. flavicauda. This new subspecies is similar to the nominate but differs from it by being darker and smaller overall. In addition, the yellow discal bar on the dorsal forewing does not reach as far into the discal cell and is more rounded anteriad, the outer margin of the yellow discal band on the hindwing is more concave, somewhat angular, and on the ventral side extends into a small tooth along the costal margin, and the outer edge of the yellow postdiscal hindwing band is more sinuous. Due to unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: Type locality. Guyana: Eastern Kanuku Mountains, Two Hat Mountain south slope summit, elevation 850 ' – 1200 ', GPS 3.1133, − 59.0983.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A72850FFE7A2D85612A9504.taxon	etymology	Etymology. In Spanish, cosita means little thing or little object and refers to a smaller size of this subspecies than many other Synargis from the regulus group. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A72850FFE7A2D85612A9504.taxon	distribution	Distribution. Currently known only from the holotype collected in Guyana. A correction to the sample number of a smaller Synargis regulus (Fabricius, 1793) In Zhang et al. (2024: 18), we stated: “ However, not all S. regulus specimens are that large, and NVG- 21119 F 08 is smaller than an average S. attilius, ” where NVG- 21119 F 08 was given by mistake. NVG- 21119 F 08 refers to the “ holotype ” of an infrasubspecific name Nymula regulus regulus forma ingens Stichel, 1925 (from Brazil: Espirito Santo). It is a large specimen with a wingspan of about 42 mm. A smaller specimen is NVG- 22117 D 10, also from Espirito Santo (Leopoldina) [MFNB], and its wingspan is about 34 mm. The number 21119 F 08 should be corrected to 22117 D 10. Both specimens are illustrated on the Butterflies of America website (Warren et al. 2024).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	description	(Figs. 12 part, 13 – 14)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Bungalotis E. Watson, 1893 (type species Papilio midas Cramer, 1775) specimens from western Ecuador reveals that they are sister to Bungalotis corentinus (Plötz, 1882) (type locality in Suriname) but are genetically differentiated from it at the species level (Fig. 12), e. g., their COI barcodes differ by 1.7 % (11 bp), and therefore represent a new species. This new species keys to “ Bungalotis diophorus ” (D. 1.2) in Evans (1952), which is a junior objective synonym of B. corentinus, and differs from it by rusty-reddish color of the dorsal side, more red than yellow (is usually yellower in B. corentinus), larger spots on wings, discal cell spot on the dorsal hindwing is oval, with brown contour, filled with ground color; some postdiscal spots may be paler in the middle; ventral side is browner, spots are larger on the ventral hindwing and filled with more extensive whitish scaling; harpe is much longer (1.5 – 2 times of B. corentinus) and the process of the ampulla is broader (Fig. 14). Due to unexplored phenotypic variation of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 276665.10.2: A 40 T, aly 349.33.2: A 303 T, aly 349.33.2: A 318 G, aly 666.26.1: C 111 T, aly 3177.6.10: G 150 A, and COI barcode: A 79 G, T 220 C, G 316 A, T 325 C, T 352 C. Barcode sequence of the holotype. Sample NVG- 17104 D 09, GenBank PQ 489702, 658 base pairs: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGGACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGATTATTACCACCTTCATTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGTACCGGATGAACAGTATATCCTCCTTTATCCTCAAATATTGC TCACCAAGGTTCTTCTGTTGATTTAGCAATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCT TTTGATCAAATACCATTATTTGTTTGAGCTGTAGGAATTACAGCAATTTTACTATTACTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTT CATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 13 (genitalia in Fig. 14), bears the following seven rectangular labels (4 th handwritten others printed with handwritten text shown in italics), six white: [Alluriquin 700 m | PICHINCHA ECUADOR | 11 Sept. ’ 76 | S. S. Nicolay], [Bungalotis | clusia ♂ | Det. E. | S. S. Nicolay], [GENITALIA NO. | X- 54 45 | J. M. Burns 2003], [LIKE ACG NOT- | diophorus ♂ USNM], [DNA sample ID: | NVG- 17104 D 09 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 00913870], and one red [HOLOTYPE ♂ | Bungalotis | corentus Grishin]. Paratype: 1 ♂ NVG- 18065 C 11 Ecuador: Esmeraldas, 500 - 800 m, Apr- 2009, ex coll. M. Büche [EBrockmann]. Type locality. Ecuador: Pichincha Province, Alluriquín, elevation 700 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	etymology	Etymology. The name is formed from the name of its sister species B. corentinus, made shorter for its new more western relative. The name is treated as a masculine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	distribution	Distribution. Currently known only from western Ecuador. http: // zoobank. org / 18 FC 50 D 7 - 3808 - 49 C 3 - 94 B 4 - A 165637 BA 641 (Figs. 12 part, 15 – 16)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	diagnosis	Definition and diagnosis. Genomic analysis of a specimen from Ecuador superficially similar to Bungalotis astylos (Cramer, 1780) (type locality in Suriname) in having ventrally brown palpi and cheeks reveals that it is sister to Bungalotis milleri H. Freeman, 1977 (type locality in Mexico: Oaxaca), which is a Central American species, but is genetically differentiated from it at the species level (Fig. 12), thus representing a new species. In mitochondrial DNA, the three species (B. milleri, B. astylos, and the new one) are not strongly differentiated from each other, although in our tree, the new species is sister to both B. milleri and B. astylos. The new species keys (incompletely) to Bungalotis astylos (D. 1.4) in Evans (1952) and is most similar to Bungalotis milleri, with the description by Freeman (1977) applicable to the male of the new species, except as stated below. In contrast to B. milleri (see Freeman 1977), the new species possesses a ray of shiny-blue scales by the costa of the dorsal hindwing (Fig. 15 bottom) characteristic of B. astylos, Bungalotis midas (Cramer, 1775) (type locality in Suriname), and Bungalotis aureus Austin, 2008 (type locality in Ecuador), and shares with B. astylos ventrally tawny-brown palpi and cheeks (except some white scales along the cheeks’ posterior). The new species differs from B. milleri and B. astylos by being darker and having browner ground color; in particular, the yellow area in the posterior part of the ventral forewing is smaller, does not reach past the postdiscal spots and vein CuA 1, and is more clearly separated from brown ground color. Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 6841.81.1: C 454 T, aly 6841.81.1: G 498 A, aly 1139.51.7: T 43 G, aly 2284.27.1: T 39 A, aly 2284.27.1: G 44 A, aly 2954.3.1: A 771 A (not C), aly 1409.11.16: C 73 C (not T), aly 2101.22.3: C 114 C (not G), aly 2101.22.3: C 117 C (not T), aly 398.2.3: C 66 C (not T), and COI barcode: T 133 C, T 340 C, A 622 A, T 646 C (the barcode may not offer reliable identification on a larger sample of specimens). Barcode sequence of the holotype. Sample NVG- 17103 H 06, GenBank PQ 489703, 658 base pairs: AACATTATATTTTATTTTTGGTATTTGAGCAGGTATAATTGGAACTTCATTAAGATTACTAATTCGAACTGAATTAGGTACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCTGACATAGCTTTTCCTCGAA TAAATAACATAAGATTTTGATTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCTGGTACTGGTTGAACAGTTTACCCACCATTATCTACTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCTTTACATTTAGCTGGTATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATCAATATACGAATTAGAAATTTATCT TTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACAGCAATCTTATTATTATTATCATTACCTGTATTAGCAGGAGCTATTACTATACTTTTAACAGATCGAAATCTTAATACTT CATTCTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATACCAACATTTATTTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 15 (genitalia in Fig. 16), bears the following six rectangular labels (2 nd and 3 rd handwritten, others printed with handwritten text shown in italics), five white: [ECUADOR: Pichincha | Tinalandia, 600 m, 16 km | E Santo Domingo de los | Colorados 18 – 22 Apr ' 90 | leg. Brian Harris], [Bungalotis | midas], [Collected at | mercury | vapor light!], [DNA sample ID: | NVG- 17103 H 06 | c / o Nick V. Grishin], [DNA sample ID: | NVG- 23116 D 05 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 00913817], and one red [HOLOTYPE ♂ | Bungalotis | amydros Grishin]. The first DNA sample refers to the extraction from a leg, and the second is from the abdomen prior to genitalia dissection. Type locality. Ecuador: Pichincha Province, 16 km east of Santo Domingo, Tinalandia, elevation 600 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	etymology	Etymology. In Greek, aμυδρός (amydros) means dim or faint and refers to reduced orange areas in this species compared to its relatives. The name is a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A748512FE372B0E63179216.taxon	distribution	Distribution. Currently known only from the holotype collected in the western slopes of the Andes in northern Ecuador.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A688510FE3A2A9F66D890D4.taxon	description	(Figs. 17 part, 18 – 19)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A688510FE3A2A9F66D890D4.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Salatis Evans, 1952 (type species Papilio salatis Stoll, 1782) specimens from Loreto Region in Peru reveals that while being sister to Salatis salatis (Stoll, 1782) (type locality in Suriname), they are most strongly differentiated genetically from it (Fig. 17), i. e., their COI barcodes differ by 4.4 % (29 bp). Therefore, these specimens represent a distinct species that is new because taxa treated as junior subjective synonyms of S. salatis, i. e., Eudamus gonatas Hewitson, 1867 (type locality in Brazil: Pará, Tapajós) and Telegonus ophiuchus Plötz, 1882 (type locality in Suriname) are phenotypically different from it in having larger spots in both sexes. This new species keys to Salatis salatis (D. 2.2) in Evans (1952) and differs from it by smaller spots in both sexes: the male is mostly rusty-orange, with only small brown spots, not pupillated with pale scales (except some larger spots on the ventral hindwing), and the female is with much smaller hyaline spots, especially the spot in the forewing discal cell is much reduced and is the smallest of all forewing spots, divided into three: the upper one is brown, the central is pupillated with a tiny hyaline dot, and the lowest is larger and mostly hyaline. Due to unexplored phenotypic variation, it is unclear whether these phenotypic characters will hold in all specimens. While we expect the specimens of this species to be mostly less patterned than S. salatis, mainly due to consistently reduced spotting in both male and female of the type series, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 1379.16.2: C 96 T, aly 536.13.6: A 162 G, aly 536.13.6: G 183 A, aly 2178.10.1: G 45 A, aly 2178.10.1: T 109 A, and COI barcode: T 25 C, C 50 T, T 127 C, A 217 G, A 268 G, T 277 C. Barcode sequence of the holotype. Sample NVG- 18101 G 08, GenBank PQ 489704, 658 base pairs: AACATTATATTTTATTTTTGGAATCTGAAGAGGTATATTAGGAACTTCTTTAAGATTATTAATTCGAACTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACA ATTGTCACAGCTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGGGCCCCTGATATAGCTTTTCCACGAA TAAATAATATAAGATTTTGATTATTGCCCCCTTCCTTAACTTTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCTCCTTTATCTGCTAATATTGC TCACCAGGGATCTTCTGTTGATTTAGCAATTTTCTCCCTTCATTTAGCCGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGTATTAGAAATTTATCT TTTGACCAAATACCATTATTCATTTGAGCTGTTGGAATTACAGCAATTTTATTATTAATTTCTTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATCTTAATACTT CATTTTTTGATCCTGCAGGAGGAGGTGATCCAATTTTATATCAACATTTATTC	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A688510FE3A2A9F66D890D4.taxon	materials_examined	Type material. Holotype: ♂ deposited in the American Museum of Natural History, New York, NY, USA (AMNH), illustrated in Fig. 18 a, bears the following four rectangular labels (1 st handwritten, others printed), three white: [Yurimaguas | Huallaye River | Peru], [G 819] (this is its genitalia slide number), [DNA sample ID: | NVG- 18101 G 08 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Salatis | minimaculatis Grishin]. The genitalia slide has not been located and will be illustrated when found. Paratype: 1 ♀: NVG- 17103 G 10 (leg sample), NVG- 23125 F 08 (abdomen extraction followed by genitalia dissection) Peru, Loreto Region, 50 mi E of Iquitos, Amazon River, Explorama Lodge, 200 m, 12 - 16 - Sep- 1990, Ron Leuschner leg. [USNM] (Fig. 18 b, genitalia in Fig. 19). Type locality. Peru: Loreto Region, Yurimaguas, Huallaga River.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A688510FE3A2A9F66D890D4.taxon	etymology	Etymology. In Latin, minimus means smallest or least significant, and maculatis means spotted or stained. The name is given for the reduced spotting in both sexes of this species and is the perfect passive participle in the nominative singular.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A688510FE3A2A9F66D890D4.taxon	distribution	Distribution. Currently known only from the Loreto Region in northeastern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A6D8517FD8728E560A1966E.taxon	description	As we demonstrated recently (Zhang et al. 2024), Achlyodes cnidus Plötz, 1884 (type locality not specified) is a valid species of Gerosis Mabille, 1903 (type species Coladenia hamiltoni Nicéville, 1889, which is a junior subjective synonym of Satarupa phisara (Moore, 1884 )) with its nomenclature stabilized by the lectotype designation. Here, we illustrate the genitalia of the lectotype (Fig. 22) and, before dissection, extracted DNA from its abdomen (NVG- 23075 D 07, sequence dataset combined with NVG- 21115 E 07 from a leg) to improve the genomic dataset that is now used in the three phylogenetic GenBank PQ 489705, 658 base pairs is: AACTCTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCTCTTAGTTTATTAATTCGAACTGAATTAGGAAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTTCCATTAATATTAGGAGCACCTGATATAGCCTTCCCACGAA TAAATAACATAAGATTTTGATTATTACCTCCATCTCTTACTCTTTTAATTTCTAGAAGTATCGTAGAAAACGGTTCAGGAACTGGTTGAACTGTTTACCCCCCTTTATCTTCTAATATTGC TCATCAAGGAGCTTCTGTTGACTTAGCTATTTTTTCATTACATTTAGCTGGTATTTCTTCTATTTTAGGAGCAATTAATTTTATTACTACTATTATTAACATACGAATTAAAAATTTATCT TTTGACCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTATTACTTCTTCTTTCACTTCCAGTTTTAGCAGGTGCTATTACAATATTATTAACAGATCGTAATCTTAATACAT CATTTTTTGATCCTGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A6C8514FE91299460A1950A.taxon	description	This syntype is the only one we were able to locate, but it agrees with the original description (Herrich-Schäffer 1870), comes from Herrich-Schäffer’s collection, and bears an identification label in Herrich-Schäffer’s handwriting “ crispus m ”, where ‘ m’ stands for ‘ mihi’ (Latin for ‘ of me’), placed after a species name as an attribution of the new species to the writer. This notation was common over a century ago, instead of the author’s name being written directly. This ‘ m’ corroborates that the label was written by Herrich-Schäffer and offers additional evidence that this specimen is a syntype. Furthermore, the original description of P. crispus specifically mentions the shiny blue colors on the ventral hindwing, translated as “ beneath dark reddish brown with a violet shimmer, especially on the inner margin half of all wings. ” Furthermore, Godman’s (1907) copy (in BMNH) of Plötz’s drawing t [afel]. 204, most likely depicting Herrich-Schäffer’s syntype of P. crispus, shows the posterior half of the ventral hindwing violet-blue, not brownish with bands and spots. Finally, the illustration of P. crispus in Draudt (1921 – 1924), which is possibly a copy of Plötz’s unpublished drawing, also shows a violet-blue tornal section of the ventral hindwing, not brown. For all these reasons, we conclude that we found and sequenced a true syntype of P. crispus and propose that Mycteris caerula Mabille, 1877, syn. nov. is a junior subjective synonym of Pellicia (Mictris) crispus Herrich-Schäffer, 1870. To stabilize nomenclature and define the name P. crispus objectively, N. V. G. hereby designates a syntype in the MFNB collection that bears the following seven labels (1 st purple, others white; 2 nd, 4 th, H. — Sch | Venezuela], [Mycteris | Crispa | HS.], [Crispus | H-Sch.], [{QR Code} http: // coll. mfn-berlin. de / u / | 940 b 8 c], [DNA sample ID: | NVG- 15032 D 09 | c / o Nick V. Grishin] as the lectotype of Pellicia crispus Herrich-Schäffer, 1870. The 2 nd and the 4 th labels are in Herrich-Schäffer’s and Staudinger’s handwriting, respectively. The word “ Venezuela ” on the 3 rd label is in the handwriting of the 5 th label and, therefore, was probably added later during subsequent curation of the collection. The lectotype has the right hindwing with a segment at the outer margin torn away, and both hindwings are partly folded at the tornus and inner margin. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024). The COI barcode sequence of the lectotype, sample NVG- 15032 D 09, GenBank PQ 489706, 658 base pairs is: AACTTTATACTTTATCTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTACTTATTCGATCTGAATTAGGTACGCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTCGGAAATTGATTAGTGCCTCTTATGTTAGGAGCTCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGATTATTACCCCCCTCTCTTACATTACTAATTTCAAGAAGTATTGTAGAAAATGGTGCTGGAACAGGTTGAACAGTTTATCCCCCTTTATCTGCTAATATTGC CCATCAAGGTTCTTCAGTTGATTTAGCTATTTTCTCTTTACATTTAGCAGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACAACCATTATCAATATACGAATTAATAAATTATTA TTTGATCAAATACCTTTATTTATTTGAGCAGTAGGAATTACAGCTTTACTTTTATTATTATCTCTTCCAGTTTTAGCTGGAGCTATTACCATACTTTTAACTGATCGTAATTTAAATACAT CTTTTTTCGACCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A6F851AFE342CD366BC9789.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that a specimen from Southeast Brazil identified as Pellicia (Mictris) cambyses (Hewitson, 1878) (type locality in Bolivia) is genetically differentiated from it at the species level (Fig. 24), e. g., their COI barcodes differ by 2.1 % (14 bp), and therefore represents a new species. This new species keys to “ Mycteris crispus crispus ” (E. 15. (b )) in Evans (1953) and was included in this taxon. It differs from its relatives by a combination of the following characters: the hindwing beneath is paler in the posterior half but without the glittering overscaling of Pellicia crispus Herrich-Schäffer, 1870 (type locality in Venezuela), and paler areas are broader than in a typical P. cambyses, including paler area right at the forewing tornus beneath; a postdiscal band of glittering spots on the dorsal hindwing is closer to the outer wing margin towards apex than in P. cambyses, in which the band bends stronger towards the base between the vein CuA 1 and the costal margin; harpes are less robust, shorter, and stronger curved dorsad (Fig. 26 a – c) than in P. cambyses, in which the left harpe is distally expanded and the right harpe is narrower (Fig. 26 d – f), and the spiculose expansion on the right ampulla is not curving inward dorsally at its base as in P. cambyses (Fig. 26 c, f). Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 2275.10.10: C 144 T, aly 1454.4.1: T 222 C, aly 1454.4.1: A 237 T, aly 1454.4.1: A 267 G, aly 1454.4.1: A 270 G, aly 279231.1.1: C 117 C (not T), aly 13198.5.4: C 48 C (not T), aly 3312.1.2: A 189 A (not G), aly 1454.4.1: C 261 C (not A), aly 164.12.1: T 2079 T (not C), and COI barcode: G 82 A, T 124 C, A 127 T, T 145 C, T 407 C, T 499 C. Barcode sequence of the holotype. Sample NVG- 18059 D 10, GenBank PQ 489707, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACATCATTAAGATTACTTATTCGATCTGAATTAGGTACACCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTTACAGCTCATGCTTTTATCATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAACATAAGATTTTGATTATTACCCCCCTCTCTTACATTATTAATTTCAAGAAGTATTGTAGAAAATGGTGTTGGAACAGGTTGAACAGTTTATCCCCCTTTATCTGCTAATATTGC TCACCAAGGTTCTTCAGTTGATTTAGCTATTTTCTCTTTACATCTAGCAGGTATTTCATCTATTTTAGGTGCTATTAATTTTATTACAACCATTATTAATATACGAATTAATAATTTATTA TTTGATCAAATACCCTTATTCATTTGAGCAGTAGGAATTACAGCTTTACTTCTATTATTATCCCTTCCAGTTTTAGCTGGAGCTATTACCATACTTTTAACTGATCGTAATTTAAATACAT CTTTTTTTGACCCTGCTGGAGGAGGTGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A6F851AFE342CD366BC9789.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 25 (genitalia in Fig. 26 a – c), bears the following seven rectangular labels (2 nd handwritten, others printed), six white: [Petropolis, | Brazil.], [Mycteris | cambyses | Hew | fide Godm], [Collection | W. Schaus], [GENITALIA NO. | X- 57 77 | J. M. Burns 2004], [DNA sample ID: | NVG- 18059 D 10 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01466804], and one red [HOLOTYPE ♂ | Pellicia (Mictris) | rio Grishin]. Type locality. Brazil: Rio de Janeiro, Petropolis. a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A6F851AFE342CD366BC9789.taxon	distribution	Distribution. Currently known only from the holotype collected in Southeast Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A61851BFED3295C667C96F6.taxon	description	a syntype in the MFNB collection that bears the following six labels (1 st and 3 rd shades of purple, others white; 3 rd and 4 th handwritten, others printed): [Origin. |?], [Hond. | Wittk.], [nis. uni- | fascia Mab.], [Unifascia | Mab.], [{QR Code} http: // coll. mfn-berlin. de / u / | 80 a 64 f], [DNA sample ID: | NVG- 15033 G 05 | c / o Nick V. Grishin] as the lectotype of Antigonus unifascia Mabille, 1889. According to its label, the lectotype was collected in Honduras by Wittkugel. The 3 rd and the 4 th labels are in Mabille’s and Staudinger’s handwriting, respectively. The lectotype has costal folds open on both wings, its abdomen and the tornus of the right hindwing are missing. Images of this specimen photographed by B. Hermier are shown on the Butterflies of America website (Warren et al. 2024).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A608519FDC22BA060A19021.taxon	diagnosis	Definition and diagnosis. Genomic analysis of Clytius Grishin, 2019 (type species Pholisora clytius Godman & Salvin, 1897) reveals a clade that does not have an available name associated with it (Fig. 27). These specimens are genetically differentiated from others at the species level, e. g., Fst / Gmin / COI barcode differences are 0.27 / 0.00 / 0.5 % (3 bp) (from Clytius unifascia (Mabille, 1889), comb. nov., stat. rest.), 0.40 / 0.009 / 2.1 % (14 bp) (from Clytius clytius (Godman & Salvin, 1897 )), and 0.36 / 0.005 / 0.9 % (6 bp) (from Clytius semitincta (Dyar, 1924), stat. rest.). Therefore, they represent a new species. Although COI barcodes are only weakly different between some of these species, nuclear genome trees (Fig. 27 a, b) and statistics substantiate their species status. This new species keys to “ Bolla clytius ” (E. 31.22) in Evans (1953) and was included in this species. The new species differs from its relatives by the following combination of characters: more uniform coloration, frequently without defined bands and only somewhat darker in the basal half of wings, usually one or two forewing subapical spots and maybe a small spot by the base of the cell CuA 1 - CuA 2, and narrower male genitalic valva with longer harper and more expanded, less concave ampulla (Figs. 29, 30). Due to the relatively cryptic nature of this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 536.132.2: A 330 G, aly 444.7.11: C 138 T, aly 2879.4.2: C 58 T, aly 1118.1.4: C 60 T, aly 1118.1. 4: C 94 T, and COI barcode: A 28 G, T 49 C, T 74 T, T 640 T, T 641 C (the barcode may not differ from C. unifascia). Barcode sequence of the holotype. Sample NVG- 5486, GenBank PQ 489708, 658 base pairs: AACTTTATACTTTATTTTTGGTATTTGGTCTGGTATAGTAGGAACTTCCTTAAGTATA	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A608519FDC22BA060A19021.taxon	description	TTAATTCGTTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATA ATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTAT AATTGGAGGATTCGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCT TTTCCCCGAATAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTATTAA TTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTT ATCAGCTAATATTGCTCATCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCTTTACAT TTAGCTGGAATTTCCTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATA TGCGAATTAATAATTTATCTTTCGATCAAATACCTTTATTTGTATGAGCTGTGGGAAT CACAGCTTTACTTTTACTTTTATCTCTACCAGTTTTAGCTGGAGCTATTACAATACTT TTAACTGATCGAAATCTTAACACGTCTTTTTTTGACCCTGCTGGTGGAGGAGATCCTA TTCTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A608519FDC22BA060A19021.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Texas A & M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 28 (genitalia in Fig. 29), bears the following six printed (text in italics handwritten) rectangular labels, five white: [TEXAS: | Hidalgo County | Bentsen-Rio Grande | Valley State Park | south of Mission], [coll. | 18 Oct 19 75 | Edward C. Knudson], [HESPERIIDAE, | Pyrginae: | Bolla clytius (God. & Salvin, 1897, | ♂ det. R. O. Kendall | M. & B. No. 66], [DNA sample ID: | NVG- 5486 | c / o Nick V. Grishin], [genitalia | NVG 160110 - 27 | Nick V. Grishin], and one red [HOLOTYPE ♂ | Clytius mattus | Grishin]. Paratypes: 18 ♂♂ and 15 ♀♀: 1 ♀ NVG- 7691 the same data as the holotype, genitalia vial NVG 170108 - 22; USA: Texas, Hidalgo Co, W. W. McGuire leg., first US record [TAMU]: 1 ♀ Santa Ana National Wildlife Refuge, 17 - Oct- 1973, 1 ♂ and 1 ♀ Abrams, 18 - Oct- 1973, and 1 ♀ Relampago at USH 281 21 - Oct- 1973; and Mexico: Tamaulipas: 1 ♂ NVG- 17108 F 04 40 mi E of Ciudad Victoria, 21 - Oct- 1974, W. W. McGuire leg. [LACM] and Roy O. Kendall & C. A. Kendall leg., [TAMU]: El Nacimiento, Rio Mante: 1 ♂ NVG- 7692 21 - Jan- 1974, genitalia vial NVG 170108 - 23, 3 ♂♂ 18 - Feb- 1974, and 1 ♀ 10 - Nov- 1974; 1 ♂ and 3 ♀♀ 28 km S of San Fernando, 16 - Dec- 1973; Sierra Cuchara, near rock quarry: 2 ♂♂ 17 - Feb- 1974 and 2 ♂♂ 24 - Feb- 1974; and 2 ♂♂ and 1 ♀ Rancho Pico de Oro, vicinity of Los Kikos, 22 - Feb- 1974; San Luis Potosi: 1 ♂ NVG- 15111 G 12 Ciudad Valles, 18 - Jun- 1974, H. A. Freeman leg. [AMNH] and ca. 16 km E of Ciudad Valles, Hotel Taninul, Roy O. Kendall & C. A. Kendall leg. [TAMU]: 1 ♂ 4 - Feb- 1980 and 1 ♀ NVG- 7693 30 - Jan- 1980, genitalia vial NVG 170108 - 24; Veracruz: 1 ♂ NVG- 15111 G 11 near Paraje Nuevo, Hacienda Potrero Viejo, 5 - Jun- 1981, J. & R. Potts leg., genitalia slide G 1705 [AMNH] and all the rest in USNM, no dates known unless specified: 1 ♂ Xalapa; 1 ♀ La Gloria, Cardel, J. Camelo G. leg.; 1 ♀ Tlacotalpan, 29 - Jul- 1897; and W. Schaus collection: 1 ♂ Paso San Juan, 1 ♀ Coatepec, and 1 ♀ NVG- 7181, USNMENT _ 01321029 Orizaba, genitalia vial NVG 161005 - 08; and 1 ♀ NVG- 18049 H 08, USNMENT _ 01466670 Oaxaca, Tuxtepec, Camelo leg. Type locality. USA: Hidalgo Co., Bentsen-Rio Grande Valley State Park.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A608519FDC22BA060A19021.taxon	etymology	Etymology. The name is formed from the word matte and is given for the dull, matte colors of this species. The name is a Latinized masculine adjective.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A608519FDC22BA060A19021.taxon	distribution	Distribution. From the lower Rio Grande Valley in South Texas, USA, to Veracruz and Oaxaca, Mexico. The southern limits of the range remain to be investigated. Suggested English name. Matte Sootywing.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A608519FDC22BA060A19021.taxon	discussion	Comment. We note that two species of Clytius have been recorded in the USA: C. clytius in Arizona and C. mattus sp. n. in Texas, confirmed by genomic sequencing (Fig. 27). A nomen nudum Pholisora elis in J. B. Smith et al., 1891 refers to a specimen of Clytius clytius (Godman & Salvin, 1897) from USA: Arizona The name Pholisora elis in Smith et al. (1891) is a nomen nudum (no description or indication published, just the name listed) of currently unknown attribution (Mielke 2005). A specimen labeled as a type of “ Pholisora Elis Edw. ” collected in “ S. W. Arizona ” was found in the USNM collection (Fig. 31). It bears the label “ Pho. Elis ♀ | Ariza ” in Edward’s handwriting, which supports the authenticity of this specimen as a reference for the name. Genomic sequencing of this specimen places it among Clytius clytius Godman & Salvin, 1897 (type locality in Mexico: Nayarit, Tres Marias Island), closest to another specimen collected in Arizona and a specimen from Mexico: Sonora (Fig. 27), thus supporting its collecting locality in the USA. Therefore, we propose to list Pholisora elis of J. B. Smith et al., 1891, nom. nud. in synonymy with Clytius clytius Godman & Salvin, 1897. Because the name P. elis is unavailable, it does not formally have type specimens, and the specimen labeled as “ Type ” is not a syntype but a regular specimen, a male, that helps us refine the synonymic placement of this name. The COI barcode sequence of this specimen, sample NVG- 22035 A 10, GenBank PQ 489709, 658 base pairs is: AACTTTATACTTTATTTTTGGTATTTGATCTGGTATAGTAGGAACTTCTTTAAGTATATTAATTCGCTCTGAACTAGGAACCCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCCCTTATATTAGGAGCCCCTGATATAGCTTTTCCCCGAA TAAATAATATAAGATTTTGACTTTTACCTCCTTCTTTAATATTACTAATTTCAAGAAGAATTGTAGAAAATGGAGCTGGAACAGGATGAACTGTTTATCCCCCTTTATCAGCTAATATTGC TCACCAAGGTTCTTCTGTAGATTTAGCCATTTTTTCATTACATTTAGCTGGAATTTCTTCTATTTTAGGTGCTATTAATTTTATTACAACTATTATTAATATACGAATTAATAATTTATCT TTCGATCAAATACCTTTATTCGTATGAGCTGTAGGAATCACAGCTTTACTTTTACTTTTATCTCTGCCAGTTTTAGCTGGAGCTATTACAATACTTTTAACTGACCGAAATCTTAATACAT CTTTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A65851DFE0B2BAC66FE95D0.taxon	description	(Figs. 32 part, 33)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A65851DFE0B2BAC66FE95D0.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of a specimen curated in MFNB as “ Origin. ” of the name “ Antigonus vulgata HS ” (either unpublished or published with misattributed authorship and misidentified, see comment below) reveals that it is related to Perus menuda (Weeks, 1902) (type locality in Bolivia, syntypes sequenced as NVG- 19055 F 05, 06, and 07), but is genetically differentiated from it at the species level (Fig. 32), e. g., their COI barcodes differ by 5.4 % (35 bp). Therefore, this specimen represents a new species. This new species keys to “ Staphylus menuda ” (E. 32.16) in Evans (1953), and might have been included in it (Evans’ female from Rio de Janeiro, Brazil: “ unh tornally with whitish scaling ”), but differs from true P. menuda by the tornal area of the ventral hindwing overscaled with cream-colored scales and more prominent cream spots overall. Differs from other relatives by a combination of rounded (not scalloped) at margin wings with brown fringes, brown head above (with some cream overscaling, but not orange or green), costal fold in males, the lack of forewing apical spots, a well-defined row of pale spots in the submarginal area of all wings above (weakly expressed on the ventral hindwing as well), diffuse paler spot at the end of the discal cell of the dorsal forewing, a pale bar at the end of the discal cell, and oval discal spots in cells CuA 1 - CuA 2 and CuA 2 - 1 A + 2 A (the latter being the largest) on both sides of hindwings. The holotype (the only known specimen) lacks an abdomen; thus, the most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 10226.6.1: C 228 T, aly 3109.11.2: A 177 G, aly 2844.9.2: A 54 G, aly 1313.29.3: A 60 T, aly 1139.2.13: A 69 C, aly 3109.11.2: T 171 T (not C), aly 536.39.4: G 207 G (not A), aly 490.12.1: A 3342 A (not G), aly 5021.7.12: T 843 T (not C), aly 5021.7.12: C 902 C (not T), and COI barcode: T 10 T, T 142 C, T 157 C, A 217 G, T 421 C, T 478 C. Barcode sequence of the holotype. Sample NVG- 21117 C 03, GenBank PQ 489710, 658 base pairs: AACTTTATATTTTATTTTCGGTATTTGATCAGGTATAGTAGGTACTTCTTTAAGTATTCTTATTCGATCAGAATTAGGAATCCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTAACAGCTCATGCTTTCATTATAATTTTTTTCATAGTAATACCTATTATAATTGGGGGATTTGGAAATTGATTAGTACCTCTTATATTAGGGGCCCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCTTCTCTCATACTTTTAATTTCAAGAAGTATTGTAGAAAATGGAGCAGGTACTGGATGAACTGTCTATCCCCCTCTTTCAGCCAATATTGC CCATCAAGGTTCATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAATATACGAATTAATAACTTATCT TTTGATCAAATACCTTTATTTGTATGAGCTGTTGGAATTACAGCTTTACTTTTATTACTATCTTTACCAGTTTTAGCTGGGGCCATTACCATACTCCTAACAGATCGAAATCTTAATACTT CTTTTTTTGATCCAGCAGGTGGAGGAGATCCTATTTTATACCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A65851DFE0B2BAC66FE95D0.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Museum für Naturkunde, Berlin, Germany (MFNB), illustrated in Fig. 33, bears the following nine rectangular labels (1 st purple, last red, others white; 2 nd, 4 th, and 6 th handwritten, others printed): [Origin.], [Ant. vulgata | ĉ HS], [Coll. H. — Sch.], [Antig. | vulgata | HS.], [Coll. | Staudinger], [type | von?], [{QR Code} http: // coll. mfn-berlin. de / u / | 908615], [DNA sample ID: | NVG- 21117 C 03 | c / o Nick V. Grishin], and [HOLOTYPE ♂ | Perus (Menuda) | tinctus Grishin]. The abdomen is missing in the holotype. Type locality. South America, as deduced by the range of related species, otherwise unknown, possibly Southeast Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A65851DFE0B2BAC66FE95D0.taxon	etymology	Etymology. In Latin, tinctus means stained, dyed, tinged, tinted, or colored. The name is given for the cream overscaling towards the tornus of the ventral hindwing, which is not expressed in its sister species. The name is a participle.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A65851DFE0B2BAC66FE95D0.taxon	distribution	Distribution. Currently known only from the holotype likely collected in South America, possibly in Southeast Brazil.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A65851DFE0B2BAC66FE95D0.taxon	discussion	Comments. The holotype of this new species, a specimen originally from Herrich-Schäffer’s collection, is most probably a specimen that Plötz intended to use in his description of a species he planned to name “ vulgata. ” Plötz effectively published this name in 1884 (Plötz 1884), but after Möschler had already described Achlyodes vulgata Möschler, 1878 (type locality in Colombia), currently a valid species of Staphylus Godman & Salvin, 1896 (type species Helias ascalaphus Staudinger, 1875). Plötz explicitly referenced A. vulgata Möschler in his 1884 description of vulgata. Therefore, vulgata, as published by Plötz in 1884, is not a new species (or a replacement name — the name is the same), even if it was Plötz’s original intention, and the specimens he used for this description, other than Möschler's two syntypes of unpublished t [afel]. 958 because it agrees with his description of A. vulgata and is curated as a type of “ vulgata ” but is not a syntype of A. vulgata Möschler, 1879. Both syntypes (male and female) of A. vulgata Möschler, 1879 are extant, and this is a third specimen. The locality “ Colombia ” in the original description likely referred to Möschler’s publication (1879) referenced by Plötz after his name “ vulgata Pl ” (Plötz 1884) because Herrich-Schäffer’s “ vulgata ” specimen lacks a locality label. We consider Plötz’s Achlyodes vulgata a misattribution and misidentification of Achlyodes vulgata Möschler, 1879, assuming that “ Pl ” after the name resulted from some mistake. “ Pl ” might have been “ inherited ” from an earlier version of the manuscript prepared before the availability of Möschler's vulgata, and it should have been “ Mösch ” instead. In any interpretation of “ vulgata Pl ”, the name vulgata cannot be used as valid for this specimen. A specimen in MFNB curated as a type of Achlyodes serapion Plötz, 1884 is a pseudotype A single specimen that, according to its label, was identified by Plötz as “ serapion ” (“ best [immt]. v [on]. Plötz ”) is placed under the handwritten on blue-green paper header label “ serapion | Plötz ” with a red handwritten label “ Typus ” pinned next to it. This specimen was photographed by Bernard Hermier; photographs shown on the Butterflies of America website (Warren et al. 2024). It is a worn specimen, which, judging from its labels, was originally from the Weymer collection, collected in Central America in 1876. Its phenotype and locality do not agree with the original description of Achlyodes serapion Plötz, 1884 (type locality Brazil: Rio de Janeiro, Nova Friburgo). Moreover, no “ i. l. ” (for in litteris, referring to unpublished names) was added to the name on the identification label of this specimen. The “ i. l. ” is typical of Plötz’s type specimens in the Weymer collection that Plötz identified before his publication. For instance, lectotypes of Pyrgus (Pyrgus) albescens Plötz, 1884 (type locality in Mexico), currently Burnsius communis albescens, and Hesperia erratica Plötz, 1883 (type locality in the USA as deduced by genomic sequencing, not Guatemala as on the specimen label and in the publication), currently a junior subjective synonym of Lon zabulon (Boisduval & Le Conte, [1837]), have “ i. l. ” on their labels. Another label includes the number of Plötz’s unpublished drawing, e. g., “ taf. 889 ” for P. albescens and “ taf. 656 ” for H. erratica. No mention of Plotz’s taf [el]. number was on the labels of the “ serapion ” specimen. Moreover, its identification label has both localities: “ N Freyburg. ” and “ Amer centr. ” The latter was possibly added later and agrees with the same statement on the locality / date / collector label, and the former likely refers to the locality given in the publication (Plötz 1884). To learn more about this putative “ serapion ” specimen, it was sampled for DNA and sequenced as NVG- 15032 H 01. The genomic analysis identified it as Staphylus (Scantilla) opites Godman & Salvin, 1896 (type locality in Guatemala) (Fig. 34 magenta within green), a species known only from Mexico and Central America. Therefore, the “ Amer centr. ” locality given on the locality / date / collector label should be correct, but “ N Freyburg. ” on the identification label simply states the type locality of A. serapion. We conclude that the specimen NVG- 15032 H 01 is not a syntype of Achlyodes serapion Plötz, 1884, because it does not closely agree with the original description and is from Central America, instead of being from the type locality in Brazil. It was probably identified by Plötz as A. serapion after this name was dorsal hindwing, this species does not agree with the original description of A. serapion, the specimen NVG- 15032 H 01 was misidentified by Plötz, possibly after the description of A. serapion. Future studies will shed light on the true identity of A. serapion. It is possible that Evans (1953) was correct, and the discovery of a male conspecific with the specimens Evans identified as A. serapion should be able to address this question. Another twist to this puzzle is offered by a specimen in MFNB (sequenced as NVG- 15032 E 04) curated as a syntype of Pellicia licisca Plötz, 1882 (type locality in Nicaragua). Although, according to its label, it was identified as P. licisca by Plötz, this specimen agrees neither with the original description nor the type locality (labeled from Brazil, not Nicaragua) of P. licisca. This specimen, identified by us as Viola minor (Hayward, 1933) (type locality in Argentina, also known from SE and S Brazil), agrees reasonably well with Godman’s copy of the unpublished drawing of A. serapion. What if, due to some label mix-up, this specimen is a syntype of A. serapion? If this was not for Evans’ choice, which may be fitting Plötz’s illustration better (if a male of that species has mostly brown ventral hindwing darker towards the base), out of all Hesperiidae known to us, V. minor may indeed be in the best agreement with all information we have about A. serapion.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A668520FF5E2E11609891C4.taxon	description	Lintneria W. H. Edwards & Butler, 1877 (type species Thanaos potrillo Lucas, 1857) is a junior homonym of Lintneria Butler, 1876 (Sphingidae). A new replacement name, Systasea, was proposed by Butler and published by Edwards (1877 b) as “ Mr. Butler proposes the name Systasea for the genus of Hesperidae [sic!] spoken of, which therefore should stand Systasea Butl ” (Edwards 1877 b). Although this work was authored by Edwards, using Article 50.1.1 of the ICZN Code, we determine that the sole author of the replacement name Systasea is Butler because “ it is clear from the contents that some person other than an author of the work is alone responsible both for the name … and for satisfying the criteria of availability other than actual publication ” (ICZN 1999), as quoted above. The name was published before 1931. Therefore, an indication (Art. 12.2.3: “ the proposal of a new replacement name (nomen novum) for an available name ”) is sufficient for “ satisfying the criteria of availability other than actual publication. ” Because this is a replacement name, according to Art. 67.8, the type species of Systasea is the same as of Lintneria, which is Thanaos potrillo Lucas, 1857. Because Thanaos potrillo Lucas, 1857 is also the type species of Cabares Godman & Salvin, 1894, according to Art. 61.3.3, Cabares Godman & Salvin, 1894 is a junior objective synonym of Systasea Butler, 1877. And because Thanaos potrillo Lucas, 1857 is currently attributed to the nominate subgenus of Autochton Hübner, 1823, Systasea Butler, 1877 is a junior subjective synonym of Autochton. Being a junior synonym, the name Systasea cannot be used as valid for the three species currently placed in this genus: Leucochitonea pulverulenta R. Felder, 1869 (type locality in Mexico: Veracruz), Hesperia zampa W. H. Edwards, 1876 (type locality in USA: Arizona), and Systasea microsticta Dyar, 1923 (type locality in Mexico: Guerrero). Moreover, these three species are not monophyletic with the type species of Systasea. To maintain the traditional usage of Systasea, we have considered referring the matter to ICZN so that the type species of Systasea is reassigned as H. zampa. However, previously, the Commission has not favored reassignment of the type species even for the genus Drosophila Fallén, 1823 (type species Musca funebris Fabricius, 1787, not Drosophila melanogaster Meigen, 1830) (ICZN 2010), probably the most widely used name of an insect. Therefore, we opted for a more straightforward solution within our means to ensure the preservation, albeit phonetic, of this name. Systasia Grishin, new genus http: // zoobank. org / 68 FC 6 FF 0 - 2 CDB- 479 F-BD 98 - ED 1 BC 6 D 17 C 5 A	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A668520FF5E2E11609891C4.taxon	type_taxon	Type species. Hesperia zampa W. H. Edwards, 1876. Definition. Genomic analysis of Pyrgini Burmeister, 1878 reveals that a phylogenetic lineage consisting of two known species (Hesperia zampa W. H. Edwards, 1876 and Leucochitonea pulverulenta R. Felder, 1869) is confidently placed in the clade with Diaeus Godman & Salvin, 1895 (type species Leucochitonea lacaena Hewitson, 1869) and Zobera Freeman, 1970 (type species Zobera albopunctata Freeman, 1970), and is sister to Onenses Godman & Salvin, 1895 (type species Leucochitonea hyalophora R. Felder, 1869) in the Z chromosome tree (Fig. 36 b). This lineage is genetically differentiated from its closest relatives at the genus level (Fig. 36): e. g., O. hyalophora COI barcode differs by 11.2 % (74 bp) from H. zampa and by 10.5 % (69 bp) from L. pulverulenta. For comparison, the human (Homo sapiens Linnaeus, 1758) and chimp (Pan troglodytes (Blumenbach, 1775 )) COI barcode difference is 9.6 % (63 bp). As discussed above, the genus-group name Systasea Butler, 1877 (type species Thanaos potrillo Lucas, 1857) traditionally applied to H. zampa and L. pulverulenta cannot be used for them because they are not monophyletic with the type species of Systasea and even belong to different subfamilies (Mielke 2005; Li et al. 2019). Therefore, because no other available genus name applies to the lineage with H. zampa and L. pulverulenta, it represents a new genus. This new genus keys to E. 56 in Evans (1953) and differs from its relatives by a combination of the following characters: apiculus is blunt; forewing apex is not truncate and the inner margin is concave, forewing is not excavate along the margin in cell CuA 2 - 1 A + 2 A and hindwing in cell Sc + R 1 - RS; the hindwing outer margin is irregular; males have a costal fold, hindtibial tuft, and thoracic pouch; uncus is narrower in dorsal view than in relatives, undivided; harpe is terminally rounded or expanded, not narrowing; costa of valva is armed with a terminally rounded curved process not shorter and only slightly narrower than harpe at its base. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 276665.11.11: T 52 C, aly 4456.14.6: T 109 G, aly 1041.8.11: C 48 T, aly 3824.3.5: A 192 G, aly 2250.3.1: A 152 G, and COI barcode: A 214 T, T 364 A, A 421 T, 547 C, T 581 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A668520FF5E2E11609891C4.taxon	etymology	Etymology. For the stability of nomenclature, the name is chosen to be as close as conceivable to Systasea. The name is a feminine noun in the nominative singular. Species included. The type species (i. e., Hesperia zampa W. H. Edwards, 1876) and Leucochitonea pulverulenta R. Felder, 1869. Parent taxon. Tribe Pyrgini Burmeister, 1878. http: // zoobank. org / 74 B 2 BC 62 - F 359 - 4945 - 91 DA-B 3 D 93 FC 9 F 53 D	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A668520FF5E2E11609891C4.taxon	type_taxon	Type species. Systasea microsticta Dyar, 1923. Definition. Genomic phylogeny of Pyrgini Burmeister, 1878 reveals that Systasea microsticta Dyar, 1923 (type locality in Mexico: Guerrero) is not monophyletic with Hesperia zampa W. H. Edwards, 1876 (type locality in USA: Arizona) and Leucochitonea pulverulenta R. Felder, 1869 (type locality Mexico: Veracruz, Orizaba) formerly in Systasea Butler, 1877 (type species Thanaos potrillo Lucas, 1857) and placed in Systasia gen. nov. above, but forms a lineage in deeper radiation of the tribe not closely related to any other single genus (Fig. 36). Therefore, this lineage represents a new genus that keys to E. 56.3 in Evans (1953) and differs from its relatives by a combination of the following characters: apiculus is blunt; forewing apex is not truncate and inner margin is concave, forewing is not excavate along the margin in cell CuA 2 - 1 A + 2 A but the hindwing margin is concave in cell Sc + R 1 - RS; hindwing outer margin is irregular but less so than in Systasia gen. nov.; males have costal fold, hindtibial tuft, and thoracic pouch; the 1 st segment of palpi is narrower and the 3 rd segment is directed somewhat outwards, tilted stronger than in relatives; forewing discal band is relatively straight, composed of several smaller semihyaline pale spots including two separate spots anteriad of the discal cell (better seen ventrally), forewing is prominently paler by the inner margin beneath (Fig. 37); uncus is divided and broader than long, arms are slightly longer than wide; sacculus is massively expanded into a spiculose process about the same size as harpe; harpe is terminally narrower, rounded, inwardly curved towards the other harpe; process from the ampulla is curved ventrad and more than twice as long as harpe, terminally semi-rhomboidal (Fig. 36 d). In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 2163.3.10: G 144 A, aly 216.30.8: T 72 A, aly 5715.3.24: G 78 A, aly 214.16.5: C 43 T, aly 1859.1.1: C 826 A, and COI barcode: A 34 T, G 38 A, T 133 C, A 190 T, A 334 G.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A668520FF5E2E11609891C4.taxon	etymology	Etymology. The name is formed from the original genus name of the type species by shortening it and adding a negating a- (i. e., not Systasea). The name is a feminine noun in the nominative singular. Species included. Only the type species (i. e., Systasea microsticta Dyar, 1923). Parent taxon. Tribe Pyrgini Burmeister, 1878.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5A8521FEC72A89634A9333.taxon	description	To stabilize nomenclature, define the name L. trifasciata objectively, and clarify its type locality that was not specified in the original description, N. V. G. hereby designates a female syntype in the BMNH collection that bears the following four labels (1 st and 2 nd round, others rectangular; 1 st with a red circle above, 2 nd yellow above, others white; 2 nd handwritten, others printed with handwritten text shown in italics): (Type) above and (H | 831) beneath, (1067), [Bolivia. | Hewitson Coll. | 79 - 69. | Leucochitonea | trifasciata. 3.], [BMNH (E) # 810335] as the lectotype of Leucochitonea trifasciata Hewitson, 1868. The lectotype lacks antennae, and its wings are angled down and secured by glue beneath. Images of the lectotype photographed by N. V. G. are shown on the Butterflies of America website (Warren et al. 2024). The type locality of T. trifasciata becomes Bolivia, according to the label of the lectotype.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5A8526FF122CE6637D91B6.taxon	description	Mielke (1993) designated a lectotype of Timochares trifasciata form obscurior Draudt, 1923 (type locality not specified) (Fig. 39 a). However, this specimen does not agree with the original description and the original illustration (Draudt 1923) (Fig. 39 e) and therefore is not a syntype. Syntypes of T. trifasciata f. obscurior were described as darker, but the “ lectotype ” is a paler specimen. The dark bands in the illustration are entire (Fig. 39 a), but they are separated into spots in the “ lectotype ” (Fig. 39 a). Austin and Warren (2002) who, per the identity of Mielke’s lectotype, placed T. trifasciata form obscurior as a synonym of Timochares ruptifasciata (Plötz, 1884) (type locality in “ South America, ” a mistake) instead of Timochares trifasciata (Hewitson, 1868) (type locality in Bolivia as indicated on the label of the lectotype), noted that additional investigations are warranted. We carried out additional investigations and found a specimen in ZfBS with the identification label “ obscurior ” in Draudt’s handwriting and typical of specimens illustrated in Draudt (1921 – 1924) (Fig. 39 f). This specimen is in the drawer of specimens that were likely illustrated in Draudt (1921 – 1924), agrees with the original description and illustration (Fig. 39 e) of T. trifasciata form obscurior, and is confidently a syntype. Invalid paralectotypes in SMF, Seitz specimens with numbers 6316 (Fig. 39 c) and 6317 (Fig 39 b) may not be syntypes of T. trifasciata form obscurior, but specimens Draudt considered to be regular T. trifasciata (Fig. 39 d). To stabilize nomenclature and define the name T. trifasciata form obscurior objectively, N. V. G. hereby designates a male syntype in the ZfBS collection (Fig. 39 f) that bears the following four rectangular labels (2 nd and 3 rd handwritten, others printed): [Rio Songo | Bolivia | 750 m | Coll. Fassl], [obscurior], [Timochares ruptifasciata Plötz | (Antigonus ))] (label folded, written on a piece of newspaper), and [DNA sample ID: | NVG- 23094 H 11 | c / o Nick V. Grishin] as the lectotype of Timochares trifasciata form obscurior Draudt, 1923. The lectotype lacks its left antenna, has nearly no damage to fringes, its right costal fold is closed, and its left fold is partly open from the base. Images of the lectotype photographed by Ernst Brockmann are shown on the Butterflies of America website (Warren et al. 2024). The type locality of T. trifasciata form obscurior becomes Bolivia: Rio Zongo, elevation 750 m, and the name returns to the synonymy with Timochares trifasciata (Hewitson, 1868) as originally proposed.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5C8525FE972DB066A196B3.taxon	description	To stabilize nomenclature and define the name A. ruptifasciata objectively, N. V. G. hereby designates the sequenced syntype, a female in the MFNB collection that bears the following seven white rectangular labels (1 st and last printed, others handwritten): [Coll. Weymer], [Ruptofasciata Plötz | no 43 best. v. Plötz], [Trifasc. Hew. ist die | binden im Hfl mehr gerade], [Antigonus (682 - 83.) | Ruptofasciata Pl.], [Ruptifasciata | Plötz i l], [56: 2.], and [DNA sample ID: | NVG- 21115 G 04 | c / o Nick V. Grishin] as the lectotype of Antigonus ruptifasciata Plötz, 1884. The number 43 possibly refers to some specimen number in Weymer’s collection, maybe a sequential number of each specimen identified by Plötz in all Plötz’s identifications of Weymer’s specimens, like “ 43 rd specimen identified by Plötz ”; best [immt]. v [on]. is for identified by; the 2 nd and 5 th labels are in Weymer's handwriting, and the 4 th label is in Plötz’s handwriting; the label 56: 2 gives a genus number (56 - Timochares) and a species number (2 - ruptifasciatus) in the Mabille catalog (1903) that was used as a guide for arranging the Hesperiidae near the apex, right forewing in the middle, and right hindwing near the tornus. The COI barcode sequence of the lectotype, sample NVG- 21115 G 04, GenBank PQ 489711, 658 base pairs is: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTCTAAGCCTTCTTATTCGAACTGAATTAGGAAATCCCGGATCATTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTCATTATAATTTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCTCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTACCCCCCCCTCTCAGCTAATATTGC ACACCAAGGTTCTTCTGTGGACTTAGCTATTTTTTCCCTACATTTAGCAGGTATCTCCTCAATTCTTGGAGCAATTAATTTTATTACAACAATTATTAATATACGAATTAGAAATTTATCC TTTGATCAAATACCCCTATTTGTCTGAGCTGTTGGTATTACAGCATTACTTTTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTCTAACTGATCGAAATCTTAATACAT CATTTTTTGATCCTGCAGGAGGGGGAGATCCAATTTTATATCAACATTTATTT Genomic comparison places the lectotype with specimens from Jamaica and not with those from continental America (Fig. 40). Wing patterns (Fig. 41) agree with this conclusion: brown spots are larger and darker and stand out with more contrast from the pale ground color in the lectotype, more similar to Jamaican specimens. Therefore, the type locality of A. ruptifasciata becomes Jamaica.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5E852BFE112CB667D294FB.taxon	description	(Figs. 39 a, 40 part, 42 – 43)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5E852BFE112CB667D294FB.taxon	diagnosis	Definition and diagnosis. As discussed above, Evans (1953) misidentified Timochares ruptifasciata (Plötz, 1884) (type locality in Jamaica) and misapplied this name to continental populations related to Jamaican T. ruptifasciata. These continental populations are genetically differentiated from T. ruptifasciata at the species level (Fig. 40), e. g., their COI barcodes differ by 3.6 % (24 bp), thus confirming phenotypic assessment of Austin and Warren (2002). Because no available name applies to this species, it is new. This new species keys to “ Timochares ruptifasciata ruptifasciata ” (F. 5.2 (a )) in Evans (1953) and was regarded as this taxon by him due to misidentification. Therefore, Evans’ key directly applies to this species, with additional comments on the identification by Austin and Warren (2002) (under the name T. ruptifasciata) who illustrated its genitalia. In summary, the new species differs from its relatives by the following combination of characters: pale yellowish-brown (frequently tan) wings with irregular brown bands separated into spots (bands are less irregular than in T. ruptifasciata); compared to T. ruptifasciata, the spots are more interconnected and less contrasting with the ground color, dorsal hindwing is usually with a yellower than redder tint, and ventral side of wings is yellow-tan rather than red-tan. In DNA, a combination of the following base pairs is diagnostic in the nuclear genome: aly 5196.11.5: A 1762 T, aly 5196.11.5: G 1789 A, aly 5196.11.5: T 1848 C, aly 16.16.5: C 72 G, aly 16. 16.5: A 99 T, and COI barcode: A 91 C, C 340 T, A 466 G, T 490 C, T 589 C, A 622 G. Barcode sequence of a paratype. Sample NVG- 17116 A 12, GenBank PQ 489712, 658 base pairs: AACTTTATACTTTATTTTTGGAATTTGGGCAGGAATAGTTGGAACTTCTCTAAGTCTTCTTATTCGAACTGAATTAGGAAATCCCGGATCCTTAATTGGAGATGATCAAATTTATAATACA ATTGTTACAGCTCATGCCTTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCATTTCCACGAA TAAATAATATAAGATTTTGACTTTTACCCCCCTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATGGAGCCGGAACAGGATGAACAGTTTATCCCCCCCTTTCAGCTAATATTGC ACATCAAGGTTCTTCTGTAGACTTAGCTATTTTTTCCCTACATTTAGCAGGTATTTCCTCAATTCTTGGAGCAATTAACTTTATTACAACAATTATTAATATGCGAATTAGAAATTTATCT TTTGACCAAATACCTTTATTTGTTTGAGCTGTTGGTATTACAGCATTACTTTTGTTATTATCTTTACCAGTTTTAGCTGGAGCTATTACTATACTTTTAACTGACCGAAATCTTAATACAT CATTTTTTGACCCTGCGGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5E852BFE112CB667D294FB.taxon	materials_examined	Type material. Holotype: ♀ deposited in the Texas A & M University Insect Collection, College Station, TX, USA (TAMU), illustrated in Fig. 42, bears the following five printed (text in italics handwritten) rectangular labels, four white: [TEXAS: | HIDALGO COUNTY, | Santa Ana National | Wildlife Refuge], [ex larva | 7 FEB 19 72 | Roy O. Kendall | & C. A. Kendall], [Larval foodplant: | MALPIGHIACEAE | Malpighia glabra | Linnaeus | (Juvenile fol. / b. buds)], [HESPERIIDAE, | Pyrginae: | Timochares ruptifas- | ciatus ruptifasciatus | (Plotz, 1884) | ♀ det. R. O. Kendall | [M. & B. No. 79 ]], and one red [HOLOTYPE ♀ | Timochares | fuscifasciata Grishin]. A female is chosen as the holotype, the same sex as the lectotypes of T. trifasciata and T. ruptifasciata. Paratypes: 6 ♂♂ and 6 ♀♀: USA: 1 ♀ NVG- 18032 B 02, USNMENT _ 01201760 Arizona, Pima Co., Baboquivari Mts., 1924, O. C. Poling leg. [USNM] and Texas: 1 ♀ NVG- 17116 A 12 Bexar Co., San Antonio, 17 - Jul- 1997, Roy O. Kendall leg., ex larva on Malpighia glabra [TAMU]; Hidalgo Co.: 1 ♀ NVG- 23074 A 11, Peñitas, 4 - Nov- 2004, N. V. Grishin leg. [NVG]; 1 ♂ NVG- 18032 B 01, USNMENT _ 01201758 Bentsen-Rio Grande Valley State Park, 18 - Oct- 1975 E. C. Knudson leg. [USNM]; Mission, 10 th Street at irrigation ditch, Roy O. Kendall & C. A. Kendall leg. [TAMU]: 1 ♂ 9 - Sep- 1972 and 1 ♀ 8 - Sep- 1972, genitalia vials NVG 130104 - 15 and NVG 130104 - 14, respectively; and 1 ♀ McAllen, Vanecia Motel, 22 - Oct- 1972, Roy O. Kendall & C. A. Kendall leg., ex larva on Malpighia glabra [TAMU] and Cameron Co., Brownsville: 1 ♂ NVG- 23124 H 07, USNMENT _ 01201759 13 - May- 1945, H. A. Freeman leg. [TAMU]; Mexico: 1 ♀ Tamaulipas, Paso del Abra, near El Abra, 1 - Apr- 1974, Roy O. Kendall & C. A. Kendall leg., ex larva on Malpighia glabra [TAMU] and 1 ♂ NVG- 19113 B 11, USNMENT _ 01602123 Sinaloa, Culiacán, 8 - Jul- 1957, G. W. Rawson leg. [USNM]; and 1 ♂ NVG- 18093 A 10 Honduras: San Pedro Sula, ex. coll. Fruhstorfer, invalid lectotype of Timochares trifasciata form obscurior Draudt, 1923 [SMF]. Type locality. USA: Texas, Hidalgo Co., Santa Ana National Wildlife Refuge.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5E852BFE112CB667D294FB.taxon	etymology	Etymology. In Latin, fuscus is brown, and fascia is a band. The name is a Latin equivalent of “ Brown-banded, ” the English name of the species found in the USA, present in the lower Rio Grande Valley of Texas in most years and straying to Arizona and New Mexico. The name is an adjective. Spots on wings are more discrete and irregular in the Jamaican species. Therefore, rupti- is in better agreement with Jamaican populations. Suggested English name. Brown-banded Skipper is the current name for this species, which is misidentified by the Latin name.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5E852BFE112CB667D294FB.taxon	distribution	Distribution. From southern USA (SE Arizona, SW New Mexico, S Texas) through Mexico to Honduras.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A5E852BFE112CB667D294FB.taxon	discussion	Comments. Primary types are the name bearers and specimens conspecific with the type bear its name. This is one of the basic principles of the ICZN Code (ICZN 1999). As in other similar cases, e. g., Hesperia colorado (Scudder, 1874) (Cong et al. 2021), Burnsius communis albescens (Plötz, 1884) (Zhang et al. 2022 a), and Nastra fusca (Grote & Robinson, 1867) (Zhang et al. 2022 c), we accept the type specimen of T. ruptifasciata as the name bearer instead of attempting to set it aside. Notably, before 2002, when Austin and Warren (2002) proposed to treat Jamaican populations of T. ruptifasciata as a distinct species Timochares runia Evans, 1953, they were considered conspecific with continental populations.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A52852EFDF42C9A67BA96FA.taxon	type_taxon	Type species. Ocybadistes hypomeloma Lower, 1911. Definition. Genomic phylogeny of the tribe Taractrocerini Voss, 1952 reveals that Potanthus hypomeloma (Lower, 1911), comb. nov. cannot be reliably assigned to existing subgenera in Potanthus Scudder, 1872 (type species Hesperia omaha Edwards, 1863) (see above) and thus represents a new subgenus. This new subgenus keys to L. 2.3 in Evans (1949) and differs from its relatives by a combination of the following characters: flattened antennal club; notched at the tip uncus not narrowing to a single point; rounded valva with a terminal small knob; narrow and irregular black discal forewing stigma in males between the veins M 3 and 1 A + 2 A; whitish inner margin of ventral hindwing; and orangeyellow spot in the cell RS-M 1 of the dorsal hindwing separated from the postdiscal band (Fig. 45 a). In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 956.3.2: T 502 C, aly 956.3.2: G 2082 A, aly 1264.8.3: G 292 C, aly 4305.13.5: G 141 A, aly 517.17.2: G 534 A, and COI barcode: T 13 C, T 52 C, T 256 C, T 358 C, A 484 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A52852EFDF42C9A67BA96FA.taxon	etymology	Etymology. This name combines the previous and current genus names of these species: Ocy [badistes] + [Pota] nthus and is a masculine noun in the nominative singular. Species included. Only the type species (i. e., Ocybadistes hypomeloma Lower, 1911). Parent taxon. Genus Potanthus Scudder, 1872.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A52852EFDF42C9A67BA96FA.taxon	description	and not Arrhenes Mabille, 1904 Genomic phylogeny of the tribe Taractrocerini Voss, 1952 that includes a pair of Padraona tranquilla Swinhoe, 1905 (type locality in Papua New Guinea: Milne Bay, a male shown in Fig. 45 b), currently in the genus Arrhenes Mabille, 1904 (type species Pamphila marnas Felder, 1860) reveals that it is not monophyletic with this genus and instead originates within Kobrona Evans, 1935 (type species Plastingia kobros Plötz, 1885). Therefore, Padraona tranquilla Swinhoe, 1905 belongs to the genus Kobrona Evans, 1935 and not Arrhenes Mabille, 1904, and we propose Kobrona tranquilla (Swinhoe, 1905), comb. nov.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A55852EFDED299360B89263.taxon	type_taxon	Type species. Padraona tranquilla Swinhoe, 1905. Definition. The lineage with Kobrona tranquilla (Swinhoe, 1905), comb. nov. represents a new subgenus due to its phenotypic distinction that caused its former misclassification as Arrhenes Mabille, 1904 (type species Pamphila marnas Felder, 1860) (see above) and notable genetic differentiation (Fig. 44), e. g., COI barcodes of the type species of Kobrona Evans, 1935, K. kobros (Plötz, 1885) (type locality in Aru), and K. tranquilla differ by 7 % (46 bp). This new subgenus keys to L. 6.6 in Evans (1949) and differs from its relatives by a combination of the following characters: not flattened antennal club; relatively long antennae, about ½ of the costal margin; rather thin 3 rd segment of palpi, not as narrow as in Ocybadistes Heron, 1894 (type species Ocybadistes walkeri Heron, 1894) but not a stout as in other Kobrona; undivided (but with side points) uncus, terminally rectangular and flat, with lateral margins nearly parallel in dorsal view and flat; expanded dorsad ampulla of the valva, with concave dorsal margin posteriad, weakly developed, knob-like harpe armed with small spines; narrow and irregular stigma in males between veins M 3 and 1 A + 2 A in the middle of the forewing; and pale-brown (not orange) and narrow spots on wings (Fig. 45 b). In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 814.12.10: G 51 A, aly 1313.18.2: T 943 C, aly 1313.18.2: T 972 C, aly 1313.18.2: A 978 C, aly 235.6. 3: T 141 C, and COI barcode: T 133 C, T 287 C, T 382 A, T 418 C, A 474 G, A 526 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A55852EFDED299360B89263.taxon	etymology	Etymology. This name combines the previous and current genus names of these species: Arrh [enes] + [Kobr] ona and is a feminine noun in the nominative singular. Species included. Only the type species (i. e., Padraona tranquilla Swinhoe, 1905). Parent taxon. Genus Kobrona Evans, 1935.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A55852FFDE62D2060B89697.taxon	type_taxon	Type species. Hesperia wama Plötz, 1885. Definition. Genomic analysis reveals that Kobrona Evans, 1935 (type species Plastingia kobros Plötz, 1885) is a genetically diverse genus (Fig. 44), e. g., COI barcodes of the type species and Kobrona sebana M. Parsons, 1986 (type locality in Papua New Guinea: Morobe District) differ by 8.1 % (53 bp). Moreover, the newly described subgenus Arrhona subgen. n., renders the rest of Kobrona paraphyletic, consisting of two other clades that represent other subgenera: the nominate subgenus sister to Arrhona and an unnamed one that includes K. sebana. For these two reasons, a morphologically distinct group of species that includes K. sebana constitutes an unnamed subgenus distinct from the nominate and Arrhona. This new subgenus keys to L. 12.1 in Evans (1949) and differs from its relatives by a combination of the following characters: terminally concave harpe densely decorated with bristles that give the distal margin appearance of a comb (as illustrated by Evans (1949) and Parsons (1986 )); tapered, weakly divided uncus with knob- or tooth-like arms; long antennae, longer than ½ of the costal margin; shorter and stouter 3 rd segment of palpi; and rather produced, not rounded, forewings. In DNA, a combination of the following T 18 C, aly 84.12.3: A 69 T, aly 349.41.4: G 834 A, and COI barcode: A 25 T, 38 T, A 88 T, T 187 C, T 190 A, C 328 C.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A55852FFDE62D2060B89697.taxon	etymology	Etymology. The name is given for the comb-like array of bristles at the distal and somewhat excavate margin of the valva. The name is a feminine noun in the nominative singular. Species included. The type species (i. e., Hesperia wama Plötz, 1885), Kobrona croma Evans, 1949, Kobrona denva Evans, 1949, Kobrona edina Evans, 1949, Kobrona idea Evans, 1949, Kobrona pansa Evans, 1935, Kobrona sebana M. Parsons, 1986, and Kobrona vanda Evans, 1949. Parent taxon. Genus Kobrona Evans, 1935.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A54852CFEDD29B760A394F0.taxon	description	http: // zoobank. org / BF 70767 A- 6 DDF- 43 FB-B 665 - EC 721 E 59 A 79 E	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A54852CFEDD29B760A394F0.taxon	type_taxon	Type species. Pamphila eurotas C. Felder, 1860. Definition. Genomic phylogeny of the tribe Taractrocerini Voss, 1952 shows a notable genetic differentiation between the clade with Arrhenes eurotas (C. Felder, 1860), comb. nov. (type locality in Ambon) and Arrhenes eurychlora (Lower, 1908), comb. nov. (type locality Australia: New South Wales, Ballina) that we placed in Arrhenes Mabille, 1904 (type species Pamphila marnas Felder, 1860) above, and other species of Arrhenes, including the type (Fig. 44), e. g., their COI barcodes differ by 7.6 – 8.7 % (50 – 57 bp). Therefore, this clade represents a new subgenus. This new subgenus keys to L. 7.1 in Evans (1949) and differs from its relatives by a combination of the following characters: undivided uncus, terminally narrow and flat; rounded valva without prominently concave dorsal margin at ampulla-harpe, without spines; long antennae, longer than ½ of the costal margin; shorter and stouter 3 rd segment of palpi; broad and straight stigma; rather narrow wings (Fig. 46) as in most species of Telicota F. Moore, 1881 (type species Papilio colon Fabricius, 1775) and not as rounded as in a typical Arrhenes Mabille, 1904. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 1841.5. 20: A 237 T, aly 1841.5.20: G 259 A, aly 600.14.1: C 84 T, aly 600.14.1: G 87 A, aly 4645.10.1: A 490 C, and COI barcode: T 70 A, A 181 T, T 376 C, T 530 C, T 547 A.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A54852CFEDD29B760A394F0.taxon	etymology	Etymology. This name combines the previous and current genus names of these species: Teli [cota] + [Arrhe] nes and is a masculine noun in the nominative singular. Species included. The type species (i. e., Pamphila eurotas C. Felder, 1860) and Telicota eurychlora Lower, 1908. Parent taxon. Genus Arrhenes Mabille, 1904.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A57852CFEDC2B9260A19180.taxon	description	Furthermore, to stabilize nomenclature and define the name T. kolbei objectively, N. V. G. hereby designates a sequenced syntype in ZSMC (Fig. 47 a), female that, according to its label, was illustrated in the original description by Ribbe (1899) and bears the following six rectangular labels (2 nd, 3 rd, and 5 th handwritten, others printed; 2 nd green, 4 th purple, others white): [Neu Pommern | Kinigunang | C. Ribbe], [abgebildet], [Kolbei | Ribbe | abgebild.], [Original], [♀ Cerone Kolbei Rib. | typ. | N. Pommern], [DNA sample ID: | NVG- 22016 H 05 | c / o Nick V. Grishin] as the lectotype of Telicota kolbei Ribbe, 1899. The lectotype has a tear near the base of the forewing costa, is missing the right antenna, and its left antenna is wide-S shaped. The COI barcode sequence of the lectotype, sample NVG- 22016 H 05, GenBank PQ 489713, 658 base pairs is: AACTTTATATTTTATTTTTGGTATTTGATCAGGAATATTAGGAACTTCCTTAAGTCTATTAATTCGTACCGAATTGGGTAACCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATCGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAATTCCCTTAATACTAGGAGCCCCTGATATAGCTTTCCCACGAA TAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACACTTTTAATTTCTAGAAGAATTGTAGAAAACGGTGCCGGAACTGGTTGAACTGTTTACCCCCCTCTTTCTTCTAATATTGC TCATCAAGGTTCCTCTGTTGATTTAGCAATCTTTTCTTTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACCACAATTATTAATATACGAATTAACAATTTATCA TTTGATCAAATACCTCTATTTATTTGATCTGTAGGAATTACAGCATTATTATTATTAATTTCATTACCAGTCTTAGCAGGAGCTATTACCATATTATTAACTGATCGAAATTTAAATACTT CATTTTTCGACCCTGCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A568532FD902E6360B595FF.taxon	type_taxon	Type species. Telicota kolbei Ribbe, 1899. Definition. Genomic analysis shows that the lineage with Sabera kolbei (Ribbe, 1899), comb. nov. (type locality in New Britain), is genetically differentiated from the type species of Sabera Swinhoe, 1908, S. caesina Hewitson, 1866) (type locality in Aru) at the subgenus level (Fig. 44), e. g., their COI barcodes differ by 8.1 % (53 bp). Therefore, this lineage represents a new subgenus. This new subgenus keys to L. 14.2 in Evans (1949) and differs from its relatives by a combination of the following characters: undivided, terminally pointed uncus, enlarged in the middle and narrowing near tegumen in dorsal view, concave towards the distal end and swollen in the middle in lateral view; tapering to a point harpe with somewhat wavy dorsal margin; long antennae, longer than ½ of the costal margin; shorter and stouter 3 rd segment of palpi; rather produced forewings; apical spots on dorsal forewing but not beyond (towards costa) vein R 3; no strong sexual dimorphism in wing pattern (Fig. 47). In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 490.12.1: A 1635 G, aly 490.12.1: T 1662 C, aly 490.12.1: A 4152 G, aly 430.8.1: T 51 A, aly 430.8.1: C 86 G, and COI barcode: G 29 T, T 127 A, A 130 T, A 286 T, T 553 A.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A568532FD902E6360B595FF.taxon	etymology	Etymology. The name is inspired by the type species name. Moreover, in several Slavic languages, the word kolba means a flask with an expanded bottom, and Kolben in German may mean a bulb. The name refers to the bulbous enlargement of uncus in the middle (in dorsal view) that is characteristic of these species and is a feminine noun in the nominative singular. Species included. The type species (i. e., Telicota kolbei Ribbe, 1899) and Telicota tenebricosa Mabille, 1904, stat. rest. Parent taxon. Genus Sabera Swinhoe, 1908.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A498532FD9A2B6560A690C3.taxon	type_taxon	Type species. Parnara sarala Nicéville, 1889. Definition. Genomic phylogeny of Acerbas Nicéville, 1895 (type species Hesperia anthea Hewitson, 1868) and relatives reveals that the genus partitions into two prominent clades with genetic differentiation that correspond to at least subgenera (Fig. 44), e. g., their COI barcodes differ by about 11.2 % (74 bp). The first clade consists of the type species of Acerbas. Because no type species of available genus-group names belongs to the second clade, it represents a new genus-group taxon that we conservatively propose as a subgenus. This new subgenus keys to J. 22.2 b in (Evans 1949) and differs from its relatives by a combination of the following characters: forewing vein 2 originates closer to the base than to the origin of vein 3; forewing discal cell with pale spots; gnathos is usually less developed than in the nominate subgenus, aedeagus is less expanded terminally, and the valva is more elongated. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 499.8.4: C 57 T, aly 171.12.1: G 39 C, aly 171.12.1: T 42 C, aly 577.55.7: C 97 A, aly 3616.1.1: A 465 G, and COI barcode: T 316 A, T 424 A, A 484 T, C 641 C, T 643 T.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A498532FD9A2B6560A690C3.taxon	etymology	Etymology. The name is tautonymous with the type species name and is a feminine noun in the nominative singular. Species included. The type species (i. e., Parnara sarala Nicéville, 1889), Carystus duris Mabille, 1883, Acerbas selta Evans, 1949, Acerbas latefascia de Jong, 1982, and Acerbas suttoni Russell, 1984. Parent taxon. Genus Acerbas Nicéville, 1895.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A488530FEA42896671C9226.taxon	description	(Figs. 49 part, 50)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A488530FEA42896671C9226.taxon	diagnosis	Definition and diagnosis. Genomic analysis of additional Notamblyscirtes J. Scott, 2006 (type species Amblyscirtes simius W. H. Edwards, 1881) specimens from across its range reveals that populations of Notamblyscirtes durango J. Scott, 2017 (type locality in Mexico: Durango) partition into two clades by their nuclear genome (Fig. 49 a, b, red and purple), thus being genetically differentiated from each other, albeit with moderate statistical support (minimal of four clades over two trees is 60 % replications). Therefore, these groups of populations represent major genomic groups of N. durango below the species level, and thus correspond to subspecies. These subspecies do not consistently differ in mitochondrial DNA (Fig. 49 c). The nominate subspecies, as the trees demonstrate (Fig. 49 purple), is known only from Mexico: states of Nuevo Leon, Coahuila, and Durango. The second subspecies inhabits southeastern Arizona and southwestern New Mexico (Fig. 49 red), does not have a name associated with it, and hence is new. The new subspecies possesses the characters given for N. durango in the original description (Scott et al. 2017) and is most similar to the nominate subspecies from Mexico in its darker aspect compared to its sister species Notamblyscirtes simius (W. H. Edwards, 1881) (type locality in USA: Colorado, Pueblo Co,), but differs in being somewhat paler (e. g., towards the base and inner margin of and typically brighter orangish postdiscal area on ventral forewing), and with sharper-defined pale spots on ventral hindwing, especially in females. Due to phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 331.20.14: C 144 T, aly 331.20.14: G 180 A, aly 4237.1.2: C 21 T, aly 164.66.3: A 39 G, aly 164. 66.3: C 57 T. There are no differences in the COI barcode. Barcode sequence of the holotype. Sample NVG- 22094 G 07, GenBank PQ 489714, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCATTAAGTTTATTAATTCGTACAGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACT ATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAATATAAGATTTTGAATATTACCCCCTTCTTTAACACTTTTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACTGGATGAACAGTTTATCCCCCACTATCATCTAATATTGC CCATCAAGGATCTTCTGTTGATATAGCAATTTTCTCCCTTCATCTAGCTGGAATTTCATCTATCTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCCTTATTTGTTTGATCTGTAGGAATTACAGCATTATTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACAATATTATTAACAGATCGTAATTTAAATACCT CTTTTTTTGACCCCGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A488530FEA42896671C9226.taxon	materials_examined	Type material. Holotype: ♂ deposited in the Los Angeles County Museum of Natural History, Los Angeles, CA, USA (LACM), illustrated in Fig. 50, bears the following five rectangular labels (2 nd handwritten, others printed with handwritten text shown in italics), four white: [Research Ranch RAB | 6 mi. S. E. Elgin, AZ. | Santa Cruz Co. | Col. 27 - Jul- 1983], [A. simius], [Amblyscirtes simius | Edwards | det. Richard Bailowitz], [DNA sample ID: | NVG- 22094 G 07 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Notamblyscirtes durango | seaza Grishin]. Paratypes: 2 ♂♂ and 4 ♀♀ USA: Arizona: Santa Cruz Co., San Rafael Valley, Bog Hole, J. P. Brock leg. [JPBrock]: 1 ♂ NVG- 21057 H 03 9 - Aug- 1992, 1 ♂ NVG- 21057 H 04 20 - Aug- 1994, 1 ♀ NVG- 21057 H 05 7 - Aug- 1993; 1 ♀ NVG- 21044 B 05 Cochise Co., Peloncillo Mts., Cottonwood Canyon, 16 - Aug- 1990, J. B. Walsh leg. [MGCL]; New Mexico, Hidalgo Co., Clanton Draw, 4 mi E of AZ state line, K. Roever leg. [MGCL]: 1 ♀ NVG- 23047 H 10 8 - Aug- 1982 and 1 ♀ NVG- 23047 H 11 1 - Aug- 1986. Type locality. USA: Arizona, Santa Cruz Co., 6 mi SE of Elgin, Research Ranch.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A488530FEA42896671C9226.taxon	etymology	Etymology. The name is formed from SE AZ (southeastern Arizona) for the type locality of this subspecies and is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A488530FEA42896671C9226.taxon	distribution	Distribution. Southeastern Arizona (Cochise and Santa Cruz Cos.) and southwestern New Mexico (Hidalgo Co.), USA.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A488530FEA42896671C9226.taxon	discussion	Comment. Traditionally, subspecies in butterflies have been defined by the differences in wing patterns between groups of populations that account for approximately 70 % of specimens. We propose a more comprehensive definition of subspecies as major genetic groups of populations within a species and apply this definition to N. durango. This definition is all-encompassing because it does not rely on a single feature of an organism, such as the coloration of adults, but is an integral characteristic of the genome and is expected to reflect genetic differences between other life stages, such as caterpillars and pupae, behavior, and foodplant preferences. Subspecies, defined as major genomic clusters, represent genetically unique divisions of a species and thus may be more relevant as units considered for conservation.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4B8536FE0E2DF766AD965D.taxon	description	(Figs. 51 part, 52 – 53)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4B8536FE0E2DF766AD965D.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that a specimen from Durango, Mexico, identified as Quasimellana mulleri (E. Bell, 1942) (type locality in Mexico: Guerrero) is genetically differentiated from it at the species level (Fig. 51), e. g., their COI barcodes differ by 5.3 % (35 bp) and therefore represents a new species. This species differs from its relatives by being darker: dorsally, two subapical orange spots are separated from the costal orange area and not connected to it through additional orange spots; ventrally, forewing dark scaling is more extensive, and the hindwing has darker marginal and basal areas giving an appearance of a faint wide central paler band (not uniformly yellow) (Fig. 52); the cornutus has a more triangular keel, rather than terminally rounded or trapezoidal, the body of cornutus is narrower; dorsodistal end of harpe is rounded and projects dorsad from the costa of the valva being separated from it by a rounded concavity (Fig. 53). Due to the cryptic nature of this species and the following base pairs is diagnostic in the nuclear genome: aly 2631.8.5: T 297 C, aly 668.9.2: A 372 G, aly 668.9.2: A 384 T, aly 668.9.2: T 393 G, aly 82.25.3: C 63 T, aly 1603.75.15: T 111 T (not G), aly 361.11.2: A 321 A (not T), aly 361.25.3: A 102 A (not G), aly 3824.6.7: C 69 C (not A), aly 3824.6.7: C 72 C (not T), and COI barcode: T 38 T, T 46 C, 79 T, A 286 T, T 304 C, T 500 C. Barcode sequence of the holotype. Sample NVG- 18117 G 05, GenBank PQ 489715, 658 base pairs: TACTTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGTACCTCCTTAAGTCTTCTAATTCGAACTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACT ATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCCTTAATATTAGGAGCCCCTGATATAGCTTTCCCCCGAA TAAATAACATAAGATTTTGAATGCTACCCCCATCATTAACCCTTCTAATTTCAAGAAGTATCGTAGAAAATGGTGCAGGAACTGGATGAACAGTTTACCCCCCCCTATCTTCTAATATCGC TCATCAAGGATCTTCTGTAGATTTAGCAATTTTTTCACTTCACTTAGCTGGAATTTCTTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGAATTAAAAACTTATCA TTTGATCAAATATCTCTATTTATTTGATCAGTAGGAATTACAGCATTATTATTATTATTATCTTTACCAGTTTTAGCTGGAGCTATTACCATATTACTTACAGACCGAAATTTAAACACAT CATTCTTCGATCCAGCAGGAGGGGGGGATCCCATTCTATACCAACACTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4B8536FE0E2DF766AD965D.taxon	materials_examined	Type material. Holotype: ♂ deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 52 (genitalia in Fig. 53), bears the following seven rectangular labels (1 st, 2 nd, and 6 th handwritten, others printed with handwritten text shown in italics), five white: [Dgo, rte 40 | Mimbres Gor | ge 28 Aug 85 | DDM], [Mellana ♂ | mulleri | Bell | det. H. A. Freeman], [GENITALIA NO. | X- 31 78 | J. M. Burns 1991], [Quasimellana mulleri | (Bell) | ♂ | det. J. M. Burns 1994], [DNA sample ID: | NVG- 18117 G 05 | c / o Nick V. Grishin], and two red [LENT BY | DOUG MULLINS | VII- 91], [HOLOTYPE ♂ | Quasimellana | duranga Grishin]. The holotype was collected by Doug Mullins.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4B8536FE0E2DF766AD965D.taxon	etymology	Etymology. The name is formed from the name of the Mexican state with the type locality and is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4B8536FE0E2DF766AD965D.taxon	distribution	Distribution. Currently known only from the holotype collected in Durango, Mexico.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4D8537FDFA297066C892E1.taxon	description	(Figs. 54 part, 55 – 56)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4D8537FDFA297066C892E1.taxon	diagnosis	Definition and diagnosis. Genomic phylogeny of Stinga Evans, 1955 (type species Pamphila morrisoni W. H. Edwards, 1878) reveals that specimens from southern Mexico identified as Stinga morrisoni (W. H. Edwards, 1878) (type locality USA: Colorado, likely in Custer Co.) are genetically differentiated from it at the species level (Fig. 54) and represent a new species. The COI barcodes are 2.3 % (15 bp) different between the holotype of the new species and the lectotype of S. morrisoni. This new species keys to M. 9. in Evans (1955) and differs from S. morrisoni by characters described in Warren and Austin (2009) for the phenotype “ in the states of México, Tlaxcala, Guerrero and Oaxaca. ” In brief, specimens of the new species are smaller than S. morrisoni in the southern parts of its range and prominently darker, with a deeper orange color, smaller spots, and reduced pale overscaling. In male genitalia (Fig. 5 c in Warren and Austin 2009), the harpe is better separated from the ampulla than in S. morrisoni, and the valva is somewhat narrower. In female genitalia (Fig. 6 c in Warren and Austin 2009), lamella postvaginalis narrows towards ductus bursae stronger than in S. morrisoni. Due to unexplored phenotypic variation in other populations, definitive identification is provided by DNA, and a combination of the following characters is diagnostic in the nuclear genome: aly 2874.23.3: C 1218 T, aly 2874.23.3: C 1296 T, aly 11945.4. 2: C 573 T, aly 11945.4.2: A 1341 C, aly 1838.49.7: A 939 G, and COI barcode: A 199 A, C 235 T, A 307 G, T 361 C, T 553 C. Barcode sequence of the holotype. Sample NVG- 23046 D 06, GenBank PQ 489716, 658 base pairs: AACCTTATATTTTATTTTTGGTATTTGAGCAGGAATATTAGGAACTTCTTTAAGTTTATTAATTCGTACAGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACC ATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCAGATATAGCTTTTCCTCGAA TAAATAATATAAGTTTTTGAATACTACCCCCTTCATTAACATTATTAATTTCAAGAAGAATTGTGGAAAATGGTGCAGGAACAGGATGAACAGTTTACCCCCCTTTATCCTCAAATATCGC TCATCAAGGATCCTCTGTTGATTTAGCAATTTTTTCTCTTCATTTGGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGAATTAAAAATTTATCA TTTGATCAAATACCTTTATTTGTATGATCTGTAGGTATTACAGCTTTATTATTACTTTTATCTTTACCCGTTTTAGCAGGTGCTATTACTATATTACTTACTGATCGAAATTTAAATACTT CTTTTTTTGATCCAGCAGGAGGAGGAGATCCAATTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4D8537FDFA297066C892E1.taxon	materials_examined	Type material. Holotype: ♂ deposited in the McGuire Center for Lepidoptera and Biodiversity Collection, Gainesville, FL, USA (MGCL), illustrated in Fig. 55, bears five printed (text in italics handwritten) labels: four white [MEXICO: MÉXICO: | Mpio. Amecameca: | S slope Iztaccihuatl: | grassy slopes above | Paso de Cortes, 3400 - | 3900 m, 18 - III- 2000 | Andrew D. Warren | with MZFC crew], [Genitalic Vial | GTA- 14079], [A. D. Warren colln. | MGCL Accession | # 2009 - 7], [DNA sample ID: | NVG- 23046 D 06 | c / o Nick V. Grishin], and one red [HOLOTYPE ♂ | Stinga azteca | Grishin]. Paratype: 1 ♀ NVG- 23046 D 07 the same data as the holotype, genitalic vial GTA- 14078. Type locality. Mexico: México, Mpio. Amecameca, south slope of Iztaccihuatl, grassy slopes above Paso de Cortés, 3400 – 3900 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4D8537FDFA297066C892E1.taxon	etymology	Etymology. The Aztec Empire flourished in central Mexico, with their capital city, Tenochtitlan, built on an island in Lake Texcoco, which is now largely filled in and forms the base of modern-day Mexico City. This species is known from central Mexico, hence the name. The name is a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4D8537FDFA297066C892E1.taxon	distribution	Distribution. Southern Mexico (México, Tlaxcala, Puebla, Guerrero, and Oaxaca).	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4F8535FE6B2B3F66AC923F.taxon	description	(Figs. 57 part, 58 – 59)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4F8535FE6B2B3F66AC923F.taxon	diagnosis	Definition and diagnosis. Genomic sequencing of a specimen initially identified as Vistigma (Vistigma) opus (Steinhauser, 2008) (type locality in Guiana) reveals that while being sister to it, it is genetically differentiated from V. opus at the species level (Fig. 57), e. g., their COI barcodes differ by 1.6 % (11 bp), and therefore represents a new species. The description of Thoon opus given by Steinhauser (2008) applies to this new species, except that the forewing discal cell spot is smaller, and there is a dot-like semihyaline spot in R 4 - R 5 cell on the dorsal side, not only ventrally, where the forewing lacks an ocherous streak in Cu 2 - 2 A cell, and the hindwing has weaker ocherous overscaling, in particular, in the discal cell and along the vestigial vein 1 A (but with streaks and overscaling along the veins as in V. opus). Due to the cryptic nature of this species and unexplored phenotypic variation, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 728.7.2: C 279 T, aly 1259.4.2: C 180 T, aly 731.4.9: G 51 A, aly 423.15.6: A 132 G, aly 216.78.1: A 528 G, aly 925. 44.2: C 75 C (not T), aly 728.13.6: A 72 A (not G), aly 1283.20.2: C 159 C (not T), aly 736.5.4: A 54 A (not G), aly 506.10.2: T 252 T (not C), and COI barcode: T 38 T, 100 G, A 211 G, T 304 C, T 541 T, 607 C. Barcode sequence of the holotype. Sample NVG- 19024 C 05, GenBank PQ 489717, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATATTAGGAACCTCTTTAAGACTATTAATCCGCACTGAATTAGGAGCTCCAGGATCATTAATTGGGGATGATCAAATTTACAACACT ATCGTAACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCAATTATAATCGGAGGATTTGGAAATTGATTAGTACCATTAATGCTAGGAGCTCCAGATATAGCTTTCCCTCGAA TAAATAATATAAGATTCTGAATATTGCCCCCTTCTTTAATATTATTAATTTCAAGAAGAATCGTAGAAAATGGTGCAGGTACTGGTTGAACTGTTTATCCCCCTCTTTCATCTAATATTGC TCATCAAGGAGCATCTGTTGACTTAGCAATTTTTTCTTTACATTTAGCAGGTATTTCTTCTATTTTAGGTGCTATTAATTTTATTACTACAATTATTAATATACGAATTAGAAATTTATCA TTTGATCAAATACCTTTATTTGTTTGATCAGTAGGTATTACCGCATTATTATTACTTTTATCCTTACCTGTATTAGCTGGAGCTATTACTATACTTTTAACTGATCGAAATTTAAATACAT CCTTTTTTGACCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATCTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4F8535FE6B2B3F66AC923F.taxon	materials_examined	Type material. Holotype: ♂ currently deposited in the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), illustrated in Fig. 58 (genitalia in Fig. 59), bears the following five printed (text in italics handwritten) rectangular labels, four white: [PERU 300 m | 30 Km S. W. | Pto. Maldonado | 24 Oct. ' 83 | S. S. Nicolay], [genitalia | ♂ slide / vial # | H 882 | Prep. S. S. Nicolay] [DNA sample ID: | NVG- 19024 C 05 | c / o Nick V. Grishin], [USNMENT | {QR Code} | 01532913], and one red [HOLOTYPE ♂ | Vistigma (Vistigma) | shnoba Grishin]. Type locality. Peru: Madre de Dios Region, 30 km southwest of Puerto Maldonado, elevation 300 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4F8535FE6B2B3F66AC923F.taxon	etymology	Etymology. The name is formed from Yiddish (shnobl) or German Schnabel for beak or nose, given for the shape of uncus that inspired the name opus for its sister species: “ because of the resemblance of the lateral view of the uncus and gnathos to the character Opus, the penguin, in the old comic strip ” (Steinhauser 2008). The name is treated as a feminine noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4F8535FE6B2B3F66AC923F.taxon	distribution	Distribution. Currently known only from the holotype collected in southeastern Peru.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4E853BFDBE2DD260CD960F.taxon	type_taxon	Type species. Styriodes quota Evans, 1955. Definition. Genomic phylogeny of Moncina A. Warren, 2008 reveals that a female from Guyana we identified as Styriodes quota Evans, 1955 (type locality in Guyana) (Fig. 61, genitalia in Fig. 62) is in a different clade from Styriodes Schaus, 1913 (type species Styriodes lyco Schaus, 1913), currently a subgenus of Mnasicles Godman, 1901 (type species Mnasicles geta Godman, 1901), and originates in deep radiation among genera such as Eprius Godman, 1901 (type species Epeus veleda Godman, 1901), Lychnuchus Hübner, [1829] (type species Lychnuchus olenus Hübner, [1829], which is a junior subjective synonym of Hesperia celsus Fabricius, 1793), and Mit Grishin, 2022 (type species Mnasitheus badius Bell, 1930), while not being particularly close to any of them (Fig. 60) and in a different clade from Mnasicles (see Fig. 6 in Zhang et al. (2023 g )). Therefore, the lineage with S. quota represents a new genus. This genus differs from its relatives by a combination of the following characters: males with a short rhomboidal brand of two segments, separated by the vein CuA 2; aedeagus with two long (slightly shorter than uncus) and arched symmetrical terminal processes; uncus is undivided, triangular in dorsal view and rather straight and narrow in lateral view; valva is elongated and rounded, with a Γ-shaped process directed dorsad (bending posteriad) from the middle of its ventral margin. In DNA, a combination of the following characters is diagnostic in the nuclear genome: aly 10672.9.2: G 159 A, aly 1456.2.1: C 129 T, aly 525.128.1: C 631 A, aly 824.26.7: C 69 T, aly 887.25.3: T 111 C, aly 1656.17.1: T 189 T (not C), aly 240.31.3: G 63 G (not C), aly 451.7.7: C 47 C (not G), aly 50.27.3: C 79 C (not T), aly 208.49.1: C 148 C (not A), and COI barcode: 79 C, T 202 G, T 232 C, A 328 T, A 415 T, T 457 C. Barcode sequence of the type species. Sample NVG- 8044, GenBank PQ 489718, 658 base pairs: AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATACTAGGAACTTCTTTAAGTTTA	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4E853BFDBE2DD260CD960F.taxon	description	CTAATTCGAACAGAATTAGGCAATCCTGGTTCTTTAATTGGAGATGATCAAATTTATA ATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTAT AATTGGAGGATTTGGAAATTGATTAGTGCCTTTAATATTAGGAGCCCCAGATATAGCC TTTCCACGAATAAATAATATAAGATTTTGAATATTACCCCCCTCACTATTATTACTAA TTTCAAGAAGAATTGTTGAAAATGGTGCAGGAACTGGTTGAACTGTTTATCCCCCTTT ATCTTCTAATATTGCTCATCAAGGTTCATCAGTTGACTTAGCAATCTTTTCTTTACAT TTAGCTGGTATTTCCTCTATTTTAGGAGCTATTAATTTCATTACTACAATCATTAATA TACGAATCAAAAACATATCATTTGATCAAATACCCTTATTTGTTTGATCAGTAGGAAT TACAGCTTTATTATTATTATTATCTTTACCTGTATTAGCAGGAGCTATTACAATACTT CTCACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCCGGAGGAGGAGATCCTA TTTTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4E853BFDBE2DD260CD960F.taxon	etymology	Etymology. The name stems from a misidentification we spotted in the USNM collection: a specimen of the type species was identified as Fig. 62. Genitalia of Alyco quota comb. nov. ♀ NVG- 8044, “ Styriodes lyco ”. Negating a- was added to lyco to vial NVG 170208 - 29, data in Fig. 61 legend: a) ventral and b) form the genus name, which is treated as a right ventrolateral views of sterigma (scale below), c) feminine noun in the nominative singular. complete genitalia in ventral view (scale on the right). Parent taxon. Subtribe Moncina A. Warren, 2008.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A4E853BFDBE2DD260CD960F.taxon	discussion	Comment. As far as we know, females of Alyco quota comb. nov. have not been reported. We take this opportunity to illustrate the female genitalia of this rarely encountered species (Fig. 62). An unusual feature of the female genitalia is lamella antevaginalis, which is ventrally expanded into a structure resembling an octopus sucker on a tentacle.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A408538FE30298F66A595BC.taxon	description	(Figs. 63 part, 64)	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A408538FE30298F66A595BC.taxon	diagnosis	Definition and diagnosis. Genomic analysis reveals that a specimen from Colombia identified as belonging to the subgenus Brasta Grishin, 2022 (type species Lychnuchus brasta Evans, 1955) of the genus Vertica Evans, 1955 (type species Hesperia verticalis Plötz, 1882) is genetically differentiated from the only known species in the subgenus Vertica (Brasta) brasta (type locality in Peru: Chanchamayo) at the species level (Fig. 63): e. g., their COI barcodes differ by 6.1 % (40 bp). In the presence of phenotypic differences, this specimen represents a new species. This new species is closest to “ Lychnuchus brasta ” (K. 12.3) and keys to it in Evans (1955) but differs by wider pale (cream-yellow) markings: broader central band (partly hyaline) on the forewing that is nearly oval rather than narrow-rectangular, beneath extending to the inner margin with a wide (nearly 2 / 5 of the wing length) pale spot; a wider pale spot at the hindwing apex, as well as the marginal pale stripe on ventral hindwing, the inner margin of the stripe is close to straight, not curving along the outer wing margin. Due to unexplored phenotypic variation in this species, most reliable identification is achieved by DNA, and a combination of the following base pairs is diagnostic in the nuclear genome: aly 116.29.8: C 117 T, aly 905.4.1: A 801 G, aly 2700.2.4: C 45 T, C 42 C (not T), aly 1038.16.2: C 198 C (not A), aly 182.2.2: C 99 C (not T), and COI barcode: T 16 C, A 40 C, T 193 C, A 412 G, T 421 C, T 589 C. Barcode sequence of the holotype. Sample NVG- 23093 E 12, GenBank PQ 489719, 658 base pairs: AACTTTATATTTTATCTTTGGTATCTGAGCAGGTATAGTCGGAACTTCTCTCAGAATATTAATTCGAACAGAATTAGGTAATCCCGGATCTTTAATCGGAGATGATCAAATTTATAACACT ATCGTTACTGCTCACGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGTTTTGGAAACTGATTAGTACCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGTA TAAATAATATAAGATTTTGAATGTTGCCCCCCTCTTTAACCCTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTATACCCCCCACTTTCATCTAATATTGC TCATCAAGGATCTTCTGTTGATTTAGCAATTTTTTCATTACACTTAGCGGGAATTTCCTCAATTTTAGGAGCAATTAATTTTATTACCACAATTATTAATATACGAATTAAAAATATATCA TTTGATCAAATACCCCTATTTATTTGATCAGTTGGAATTACAGCTTTATTATTAATTTTATCTTTACCAGTATTAGCTGGAGCTATTACAATACTTCTTACTGACCGAAATTTAAATACCT CCTTTTTTGATCCTGCAGGAGGAGGAGATCCAATCCTATATCAACATTTATTT	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A408538FE30298F66A595BC.taxon	materials_examined	Type material. Holotype: ♂ deposited in the collection of the Zentrum für Biodokumentation des Saarlandes, Schiffweiler, Germany (ZfBS), illustrated in Fig. 64, bears the following five rectangular labels (2 nd handwritten, 3 rd without text, others printed; 3 rd and the last red, others white): [Rio Aguacatal | Colomb. W. Codr. | 2000 m | Coll. Fassl], [?], [] no text on this red label, [DNA sample ID: | NVG- 23093 E 12 | c / o Nick V. Grishin], [HOLOTYPE ♂ | Vertica (Brasta) | asta Grishin]. Type locality. Colombia: Valle del Cauca, Río Aguacatal, elevation ca. 2000 m.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A408538FE30298F66A595BC.taxon	etymology	Etymology. The name is formed from its sister species name, which is made shorter to indicate a more northern distribution of this species. The name is treated as a noun in apposition.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
E87A9B1F9A408538FE30298F66A595BC.taxon	distribution	Distribution. Currently known only from the holotype collected in western Colombia.	en	Zhang, Jing, Cong, Qian, Shen, Jinhui, Song, Leina, Grishin, Nick V. (2024): New taxa of butterflies supported by genomic analysis. The Taxonomic Report of the International Lepidoptera Survey 12 (3): 1-63
