Chloropsina minima (Becker, 1911)

Figs. 1A–C

Examined specimens. 1 ♀ SINGAPORE, NUS Campus: Ventus, 1°17’45.300’’N, 103°46’13.800’’E, 15 m, Urban Area (managed vegetation), Malaise trap, 22.xi.2017, SDE Insect Survey 2017 leg. (code ZRCBDP0303565) ; 1 ♂ NUS Bukit Timah Campus: Centre for Urban Greenery and Ecology (CUGE) , 1°19’10.100’’N, 103°48’59.200’’E, urban area (managed vegetation), Malaise trap, 15.xii.2017, SDE Insect Survey 2017 leg. (ZRCBDP0298668) .

Diagnosis. Ocellar triangle large, black; scutum yellow with black longitudinal stripes; scutellum yellow; male terminalia with pre- and postgonites fused; surstylus hook-shaped, with a few spines, apex directed ventrally; mesolobus absent.

Barcode. Cytochrome oxidase I (COI) partial-cds (313 b.p.; GenBank accession code OR776884) as follows:

TCATCAATTATTGCTCATGGTGGAGCATCAGTTGATTTAGCTANNTTNNCATTACATTTAGCAGGAGTTTCATCAATTTTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGATCAACAGGTATTACTTTTGATCGAATACCATTATTTGTTTGATCTGTTGTAATTACTGCATTATTATTACTTTTATCTTT ACCAGTATTAGCAGGAGCTATCACTATATTACTAACAGATCGAAATTTAAATACTTCANNNTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATACCAACATTTATTT

Remarks. Here we provide the first photo and DNA barcode of Chloropsina minima . The species was identified using Kanmiya’s (1983) key to Japanese Chloropsina species and its original description (Becker, 1911). The phallapodemic sclerite is poorly sclerotized, the fused pre- and postgonite has an indentation, and the distiphallus is longer than that of the specimen from Japan (Kanmyia, 1983; fig. 339). These features are considered intraspecific variations. The morphology of the surstylus and the fusion of the gonites are similar.

Distribution. Japan, Java, Korea, Philippines, Singapore *, Sumatra, Taiwan.