Rhaphium hongkongense sp. nov.
urn:lsid:zoobank.org:act: 69130531-6D7A-4CA4-BAEF-6D6FF5E35AC5
Figs 1–2
Diagnosis
Small species with long postpedicel (almost 5 × as long as wide), biseriate acrostichals, five pairs of dorsocentral bristles, simple cerci and apically simple surstyli. Fore tarsomere 1 ventrally produced, bearing only minute apical spines. Surstylus yellowish, with club-shaped tip.
Etymology
The new species is named after the type locality Hong Kong.
Material examined
Holotype HONG KONG • ♂; Tai Tan (28M1); 22.43857° N, 114.33327° E; 5–19 Dec. 2017; C. Taylor and U. Chang leg.; muddy front mangrove near forest; RBINS.
Paratypes HONG KONG • 47 ex.; same collection data as for holotype; barcoded; RBINS • 4 ♂♂, 1 ♀; Sam A. Tsuen (5AM1); 22.51534° N, 114.27121° E; 11–27 Dec. 2017; C. Taylor and U. Chang leg.; muddy back mangrove; RBINS • 1 ex.; To Kwa Peng (29M1); 22.42863° N, 114.33314° E; 29 Nov.–5 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 6 ex.; Sai Keng (40M1); 22.42041° N, 114.26796° E; 18 Dec. 2017 – 2 Jan. 2018; C. Taylor and U. Chang leg.; barcoded; RBINS • 3 ex.; Ho Chung (Nam Wai) (38AM1); 22.35347° N, 114.25622° E; 4–18 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 72 ex.; Sam A Tsuen (5AM1); 22.51534° N, 114.27121° E; 11–27 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 26 ex.; Sam A Chung (5BM1); 22.50829° N, 114.27248° E; 11–27 Dec. 2017; C. Taylor and U. Chang leg.; barcoded; RBINS • 1 ♂, 1 ♀; same collection data as for preceding; barcoded; HKU .
Barcodes
The barcodes below can be copy/pasted into a fasta file in order to compare with other species.
>doli_HKC0000723_Kareen_ INTRN 220_ HongKong _ 31Dec 9999_20180820 male Sam A Tsuen (5 AM 1) AAATAAATGTTGATATAATACAGGGTCACCACCTCCTGCGGGATCAAAAAATGAAGTATTTA AGTTTCGGTCTGTTAATAGTATGGTGATGGCTCCTGCTAATACTGGTAATGATAATAATAATA GAATAGCTGTAATTACTACAGATCAGACAAATAAAGGTATACGATCTAATGTAATTCCTGTG GATCGTATATTAATAACTGTTGTAATGAAATTCACTGCTCCTAGAATTGATGAAATTCCGGCT AAATGTAATGAAAAAATAGCTAAATCTACAGAGGCACCTCCATGAGCAATTCCTGCTGAGA GG
>doli_HKC0000712_Kareen_ INTRN 220_ HongKong _ 31Dec 9999_20180820 female Sam A Tsuen (5 AM 1) AAATAAATGTTGATATAATACAGGGTCACCACCTCCTGCGGGATCAAAAAATGAAGTATTTA AGTTTCGGTCTGTTAATAGTATGGTGATGGCTCCTGCTAATACTGGTAATGATAATAATAATA GAATAGCTGTAATTACTACAGATCAGACAAATAAAGGTATACGATCTAATGTAATTCCTGTG GATCGTATATTAATAACTGTTGTAATGAAATTCACTGCTCCTAGAATTGATGAAATTCCGGCT AAATGTAATGAAAAAATAGCTAAATCTACAGAGGCACCTCCATGAGCAATTCCTGCTGAGA GG
Description
Male
MEASUREMENTS. Body: 2.3–2.4 mm long; wing: 2.45–2.5 mm long.
HEAD. Antenna with scape and pedicel yellowish brown, postpedicel brownish black; arista black. Postpedicel 5 × as long as wide; arista short (a third of the length of the postpedicel); basal aristal segment short, 0.15 × length of arista (0.0225 mm / 0.15 mm). Palpus yellowish. Vertical bristles a little shorter than ocellars. Upper four postoculars black, lower postoculars whitish, multiseriate.
THORAX. Acrostichals biseriate, rows close together, present on anterior half of mesonotum. 5 long dorsocentrals, equally long. A pair of long scutellar bristles.
LEGS. Yellow except mid and hind coxae anteriorly brownish, hind femur and tibia dusky yellowish. Fore and mid tarsomeres 3, 4 and 5 brown; hind tarsomere 1 with brown tip, following tarsomeres entirely brown.
FORE LEG. Coxa with short anterior bristles and one or two black bristles (Fig. 2A). Femur with one preapical posteroventral bristle. Tibia with one dorsal at basal quarter (Fig. 2C). Tip of tarsomere 1 ventrally with short spinules, tip produced, bearing minute curved apical spines (Fig. 2D).
MID LEG. Coxa with a fine brown exterior bristle. Femur with a preapical anterior and a larger posterior. Tibia with one long anterodorsal on basal 1/5, one shorter posterodorsal and one anterodorsal near middle.
HIND LEG. Hind coxa lacking an exterior bristle. Femur with an indistinct anterior preapical, minute ventrals. Tibia with two anterodorsals, two posterodorsals and an apical crown of bristles.
WING. Brownish with brown veins (Fig. 1). Squama white with white cilia. Haltere white.
ABDOMEN. Paler than thorax, venter yellowish with minute hairs. Only tergite 1 with long marginal bristles.
MALE TERMINALIA (Fig. 2). Surstylus yellowish, with club-shaped tip (Fig. 2E). Cercus whitish, very long and thin, its tip reaching tip of sternite 3.
Female
MEASUREMENTS. Body: 2.56–2.6 mm long; wing 2.5–3 mm long.
HEAD. Antenna shorter than in male. Scape and pedicel yellow, postpedicel and arista black. Postpedicel about 3–3.5 × as long as wide. Arista longer than postpedicel (about 1.2 ×).
LEGS. Fore coxa with a few short black bristles near tip. Fore tibia with 2 long preapical posteroventrals.
Remarks
Rhaphium hongkongense sp. nov. and R. spinulatum sp. nov. may be distinguished from other species of Rhaphium in China by the combination of a postpedicel 5–6 × as long as wide, biseriate acrostichals, five pairs of dorsocentral bristles, simple cerci and apically simple surstyli.
In having five dc and fore coxa yellow, mid and hind coxae black (or at least brownish anteriorly), the surstylus with only sparse short hairs and the cercus long triangular, the two new species come close to R. qinghaiense Yang, 1998 (Yang et al. 2011: fig. 810). However, in the latter the hind tibia is black, the postpedicel is shorter, the cercus is also shorter and differently shaped (broad at base, 4 × as long as wide) and the surstylus is also different.
In the key to Chinese Rhaphium provided by Tang et al. (2016), both R. hongkongense sp. nov. and R. spinulatum sp. nov. would key out between R. furcatum Yang & Saigusa, 2000 and R. palliaristatum Yang & Saigusa, 2001 . Both species may be distinguished from R. palliaristatum by the colour of the basal antennal segments (uniformly black or brown rather than pale yellow with a black base), and from R. furcatum by the presence of acrostichal bristles and the apically non-bifurcated surstylus. Rhaphium hongkongense sp. nov. is larger than R. spinulatum sp. nov. The basal aristal segment is shorter. The tip of the fore tarsomere 1 is more produced, but apical spinules are indistinct. The surstylus is yellowish with a club-shaped tip, while in R. spinulatum sp. nov. the surstylus is black, with a slender, pointed tip. The mid coxa has a fine brown exterior bristle and the mid coxa bears a white exterior bristle.